ID: 966509810

View in Genome Browser
Species Human (GRCh38)
Location 3:180749322-180749344
Sequence CTTTAAGAGCAGAAGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 899
Summary {0: 1, 1: 2, 2: 3, 3: 51, 4: 842}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966509806_966509810 6 Left 966509806 3:180749293-180749315 CCTACAATGTCTATGCTTTACTT 0: 1
1: 0
2: 0
3: 22
4: 309
Right 966509810 3:180749322-180749344 CTTTAAGAGCAGAAGGAGGGTGG 0: 1
1: 2
2: 3
3: 51
4: 842

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966509810 Original CRISPR CTTTAAGAGCAGAAGGAGGG TGG Intronic
900337207 1:2170145-2170167 CGTTAGGAGCAGAACGAGAGTGG + Intronic
900456890 1:2779564-2779586 CTTTGAGAGGCCAAGGAGGGTGG - Intronic
900638692 1:3677946-3677968 CTTTAGGAGGCCAAGGAGGGAGG - Intronic
900786284 1:4652820-4652842 CATTAAGAGGCGAAGGAGGCAGG - Intergenic
900985740 1:6072028-6072050 CCTTAGGAGGTGAAGGAGGGTGG - Intronic
901208747 1:7512584-7512606 TTCTGAGAGCAGAAGGCGGGAGG + Intronic
901416577 1:9120648-9120670 CTTTAACTGCAGAAGGGGAGAGG + Intronic
901482068 1:9532111-9532133 CTTTCAGAGGCGGAGGAGGGTGG - Intergenic
901505498 1:9682791-9682813 CTTTGAGAGGCCAAGGAGGGTGG - Intronic
901661681 1:10802094-10802116 CTTTAGGAGGCGGAGGAGGGTGG - Intergenic
901776569 1:11564179-11564201 CTTTGGGAGCCCAAGGAGGGAGG + Intergenic
901911767 1:12464573-12464595 CTAAAAGAACATAAGGAGGGGGG - Intronic
902007691 1:13245448-13245470 CTTTAGGAGCCCAAGGTGGGCGG - Intergenic
902566072 1:17312214-17312236 CTTTAGGAGACCAAGGAGGGTGG + Intronic
902976232 1:20090534-20090556 CACCAAGAGCAGAATGAGGGTGG - Intronic
903295600 1:22341477-22341499 CTTTGAGAGGCCAAGGAGGGTGG - Intergenic
903348546 1:22703681-22703703 CTTGAGGAGCAGAAAGAGTGTGG - Intergenic
903651768 1:24926939-24926961 CTTGAGCAGCAGAAGGAAGGCGG - Intronic
903827595 1:26156843-26156865 CTTTAAGACCAAAGGGATGGGGG + Intergenic
903921034 1:26801034-26801056 CTTTGGGAGCCCAAGGAGGGTGG - Intergenic
904079670 1:27864118-27864140 CTTTAAGAGGCCAAGGCGGGTGG - Intergenic
904216832 1:28927674-28927696 ATTTAAGAGGAGAAGGAGAAAGG - Intronic
905392953 1:37649961-37649983 CTTCAAGAGTAGGAAGAGGGTGG + Intergenic
905469092 1:38178308-38178330 CTTTAAGAGGCCAAGGTGGGCGG - Intergenic
905483488 1:38278107-38278129 CTTTTAGAGAATAAGAAGGGTGG - Intergenic
905738948 1:40352769-40352791 CTTTAGGAGGCCAAGGAGGGAGG - Intronic
905741732 1:40377040-40377062 CTTTGAGAGGCCAAGGAGGGAGG + Intronic
905817417 1:40962606-40962628 CTTTGAGAGGTGAAGGCGGGTGG - Intergenic
905883221 1:41477838-41477860 CTTTAAGAGGCCAAGGTGGGAGG - Intergenic
905996878 1:42388907-42388929 CACCAAGAGCAGAAGTAGGGAGG + Intronic
906860334 1:49352526-49352548 CTGGAAGGCCAGAAGGAGGGGGG - Intronic
906985896 1:50682848-50682870 CTTTGGGAGGAAAAGGAGGGCGG + Intronic
906989796 1:50725697-50725719 CTTTAGGAGGCGGAGGAGGGTGG - Intronic
907004051 1:50892485-50892507 CTTAAAGAGCTGAAGGGAGGCGG - Intronic
907476939 1:54712146-54712168 CTTTAAGAGGCCAAGGTGGGAGG + Intronic
907739494 1:57150910-57150932 CTTTGAGAGGCCAAGGAGGGAGG + Intronic
908070071 1:60450673-60450695 CATGAAGAGAAAAAGGAGGGTGG - Intergenic
908261858 1:62345270-62345292 CGTTAAGAGCAGATGGAGGCTGG + Intergenic
908369438 1:63467124-63467146 CTTTAGGAGGCCAAGGAGGGAGG - Intronic
909308490 1:74114088-74114110 CAATAAGAGCACAAGGAGGCAGG + Intronic
910347672 1:86259032-86259054 CTTTATGAGGAGCAGCAGGGAGG + Intergenic
912313488 1:108646144-108646166 CTTTGAGAGCAGGAATAGGGTGG + Intergenic
912798366 1:112706302-112706324 CTTTAAAACCAGAGTGAGGGCGG + Intronic
912835813 1:112995391-112995413 CTTTGGGAGCCCAAGGAGGGTGG - Intergenic
912868617 1:113282697-113282719 CTTGAAGAGAAGAATGGGGGAGG - Intergenic
913586099 1:120277367-120277389 CTATAAGACCAAAAGGAGTGTGG - Intergenic
913622087 1:120621002-120621024 CTATAAGACCAAAAGGAGTGTGG + Intergenic
914247698 1:145898043-145898065 CTTCAAGAGAAAAGGGAGGGAGG - Intronic
914568108 1:148889225-148889247 CTATAAGACCAAAAGGAGTGTGG - Intronic
914604716 1:149241024-149241046 CTATAAGACCAAAAGGAGTGTGG + Intergenic
915071656 1:153273404-153273426 CTTTGAGAGGACAAGGAGGGCGG - Intergenic
915287292 1:154861196-154861218 CTTTGAGAGGCCAAGGAGGGTGG - Intronic
915303865 1:154966857-154966879 CTTTCAGAGGCCAAGGAGGGAGG + Intronic
915615726 1:157036616-157036638 TTTTAAGAGAAGCAGGAGGCTGG - Intronic
916273754 1:162971648-162971670 ATTTAAGTGCACAAGGTGGGTGG + Intergenic
916409489 1:164531497-164531519 CTTTGGGAGATGAAGGAGGGAGG - Intergenic
916618276 1:166467832-166467854 CTTTAAGAGGCAGAGGAGGGAGG + Intergenic
916740991 1:167646884-167646906 CTTTGGGAGGACAAGGAGGGTGG + Intronic
917087960 1:171322607-171322629 CTTTAAGAGGCCAAGGCGGGTGG + Intronic
917386572 1:174482718-174482740 CTTTGAGAGTCCAAGGAGGGAGG - Intronic
917769348 1:178259805-178259827 CTTTGAGAGGCCAAGGAGGGAGG - Intronic
917865768 1:179193647-179193669 CTTTGAGAGGCCAAGGAGGGTGG - Intronic
918308546 1:183268796-183268818 CTTTAAGAGGCCAAGGTGGGAGG + Intronic
918450611 1:184654109-184654131 CTTTAAGAGGCCAAGGTGGGAGG + Intergenic
918488370 1:185053594-185053616 CTTTGAGAGGCCAAGGAGGGAGG - Intronic
919516525 1:198532276-198532298 CTTTAAGAAAAGAAGGAGGAAGG + Intronic
919664923 1:200282753-200282775 CTTTCTCAGCAGCAGGAGGGAGG + Intergenic
919714688 1:200763830-200763852 CTTTAGGAGGCCAAGGAGGGTGG + Intronic
919788407 1:201274924-201274946 CTCTAAGAGCTCAAGGAAGGAGG + Intergenic
919795302 1:201318013-201318035 GTTAAAGAGCAAAAGGAGGAAGG + Intronic
919837731 1:201587440-201587462 CTTTAAGAGGCCAAGGGGGGTGG + Intergenic
920013968 1:202890700-202890722 CTTCCAGAGCAAAAGGAAGGAGG - Intergenic
920453333 1:206077526-206077548 CTTTGGGAGGGGAAGGAGGGAGG + Intronic
920607446 1:207402523-207402545 CTTTAAGAGGCCAAGGCGGGAGG - Intergenic
920704323 1:208240746-208240768 CTTTATGATCAGAATGGGGGTGG + Intronic
921856617 1:219992989-219993011 CTTTGAGAGGTCAAGGAGGGCGG + Intronic
922593108 1:226793505-226793527 CTTTAAAAACAGAAAGAGGCCGG + Intergenic
922736598 1:227986383-227986405 CTTTAAGAGGCCAAGGTGGGAGG + Intergenic
922965621 1:229688641-229688663 CTTTCAGAGGTCAAGGAGGGCGG + Intergenic
923199731 1:231699662-231699684 TAGTAAGAGCAGAAGAAGGGAGG - Intronic
923856430 1:237849799-237849821 ATTGAAGAGGAGAGGGAGGGAGG + Intergenic
923976454 1:239270013-239270035 ATTAAAGAGCAGAAGAAGGCTGG + Intergenic
923998554 1:239525117-239525139 CTTTGAGAGGCCAAGGAGGGAGG + Intronic
924113441 1:240722807-240722829 CTTTGAGAGGCCAAGGAGGGAGG - Intergenic
924489086 1:244517526-244517548 CTTTAGGAGGAGGAGGTGGGTGG + Intronic
924620890 1:245659793-245659815 CTTTGAGAGCCCAAGGAGGGCGG + Intronic
924683709 1:246265380-246265402 CTTTGAGAGGCCAAGGAGGGAGG - Intronic
924948951 1:248865261-248865283 CTTTGGGAGCTCAAGGAGGGAGG - Intergenic
1063267284 10:4467451-4467473 ATGGAAGAGGAGAAGGAGGGTGG - Intergenic
1063896155 10:10684497-10684519 CTTTGAGAGGACAAGGCGGGTGG + Intergenic
1063963642 10:11327865-11327887 CTTTAATAGCAGATGGATAGAGG + Intronic
1064068728 10:12206713-12206735 CTTTAGGAGGCCAAGGAGGGCGG + Intronic
1064551245 10:16503162-16503184 CTTTGAGAGGACAAGGTGGGTGG - Intronic
1064885214 10:20103981-20104003 CTTTCAGAGCAGAAGGACATGGG + Intronic
1065186562 10:23174741-23174763 CTTTCAGAGCAGGAGCACGGAGG - Intergenic
1065280743 10:24135182-24135204 CTCCAAGAGGAGAAGGAGGATGG + Intronic
1065420846 10:25542577-25542599 CTTTGAGAGGTCAAGGAGGGTGG + Intronic
1065675268 10:28167065-28167087 CTTTAGGAGGCCAAGGAGGGCGG + Intronic
1065699401 10:28410330-28410352 CTTTAGGAGCCTGAGGAGGGAGG - Intergenic
1065722015 10:28636286-28636308 CTTTAGGAGGCTAAGGAGGGTGG + Intergenic
1065747221 10:28853518-28853540 CTTCAGGACCAGAAGCAGGGTGG + Intronic
1065812299 10:29453330-29453352 CTTTGAGAGGCCAAGGAGGGAGG - Intergenic
1066255269 10:33672493-33672515 CTTTGGGAGAATAAGGAGGGAGG + Intergenic
1067058820 10:43067433-43067455 CCCTAGGAGAAGAAGGAGGGGGG + Intergenic
1067109773 10:43391999-43392021 CTTTAGGAGGTCAAGGAGGGTGG + Intronic
1068227016 10:54118415-54118437 CTTTGAGAGGCCAAGGAGGGCGG + Intronic
1068412073 10:56669156-56669178 CTTTAATGGCAAAAGGAGTGAGG + Intergenic
1068453612 10:57226407-57226429 CAGGAAGAGCAGAAGTAGGGAGG + Intergenic
1068706570 10:60083081-60083103 CTCCAAGAACAGAAGGAGAGAGG - Intronic
1069109569 10:64429199-64429221 CTTTAAGAGGCCAAGGTGGGAGG - Intergenic
1069126167 10:64637125-64637147 CTTTGAGAGGCCAAGGAGGGAGG - Intergenic
1069155258 10:65021639-65021661 CTTTAGGAGTCCAAGGAGGGTGG + Intergenic
1069580336 10:69561584-69561606 ATGCAAGAGCAGAAGAAGGGGGG + Intergenic
1070253523 10:74794335-74794357 CTTTAAGAGGCCAAGGCGGGTGG + Intergenic
1070294798 10:75151593-75151615 CTTTAAGAGGCCAAGGTGGGAGG - Intronic
1070357073 10:75650702-75650724 CTTTAAAAGGAAAGGGAGGGAGG + Intronic
1070627002 10:78058367-78058389 CTTTGAGAGGCCAAGGAGGGAGG - Intergenic
1072590188 10:96821961-96821983 CTTTGGGAGGCGAAGGAGGGTGG + Intergenic
1072717924 10:97763685-97763707 CTTTGGGAGGACAAGGAGGGAGG + Intergenic
1072728885 10:97831521-97831543 CATTAGGAGCAGATGGAGGGAGG + Intergenic
1073365883 10:102940659-102940681 CTTTAGGAGGCCAAGGAGGGCGG - Intronic
1073482734 10:103797276-103797298 CTGTGAGAGAAGAAGGTGGGTGG + Intronic
1074021515 10:109589197-109589219 CTTTAAGAGGCCAAGGTGGGTGG + Intergenic
1075057075 10:119227097-119227119 CTTTGAGAGGCCAAGGAGGGCGG - Intronic
1075706293 10:124503946-124503968 CTTTAGGAGTCCAAGGAGGGCGG + Intronic
1076021436 10:127076944-127076966 CTTTGAGAACAGAGGCAGGGAGG + Intronic
1076091087 10:127686281-127686303 CTTGGAAAGCAGAAGGTGGGTGG + Intergenic
1076762175 10:132611309-132611331 CTGTCAGAGGAGAATGAGGGAGG + Intronic
1077623735 11:3751613-3751635 CTTTAAGAGCTCAAGGCAGGAGG + Intronic
1078208990 11:9254827-9254849 CTTTAAGAGGCCAAGGAGGGTGG + Intronic
1078391952 11:10942699-10942721 CATTAAGAGCAGGAAGAGGTAGG - Intergenic
1079065351 11:17286278-17286300 CTTTGTGAGGACAAGGAGGGTGG - Intronic
1080516527 11:33026869-33026891 CTTTAGGAGCACAAGATGGGAGG - Intronic
1080535026 11:33213037-33213059 CTTTAGGAGGCTAAGGAGGGCGG + Intergenic
1080539902 11:33256153-33256175 CTTTAAGAGACAAAGGAGGCCGG - Intergenic
1080552630 11:33386861-33386883 CTTTGGGAGCCCAAGGAGGGTGG + Intergenic
1081141366 11:39505062-39505084 CTTTAAGACCAGGTGGAGAGAGG - Intergenic
1081880300 11:46444489-46444511 CTGTCTGATCAGAAGGAGGGTGG - Intronic
1082862668 11:57870803-57870825 CTTTGAGAGGCCAAGGAGGGTGG + Intergenic
1082943225 11:58730229-58730251 CTTTCAGAGGCCAAGGAGGGAGG + Intronic
1083470201 11:62879348-62879370 CTTTAGGAGGCCAAGGAGGGAGG - Intronic
1083806066 11:65074816-65074838 CTTTAGGAGGCCAAGGAGGGTGG + Intronic
1083964093 11:66032255-66032277 CTTTGGGAGCACAAGGCGGGTGG - Intergenic
1083988619 11:66233080-66233102 CTCTAAGGGCAGGAGAAGGGAGG - Intronic
1084017219 11:66391718-66391740 CTTTGAGAGGACAAGGTGGGTGG + Intergenic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1084902805 11:72322242-72322264 CTTTAGCAGCAAAAGGAGGATGG - Intronic
1086742245 11:90382197-90382219 CTTTGAGAGGCCAAGGAGGGAGG - Intergenic
1086777367 11:90855729-90855751 CTTTAAGAGGCCAAGGTGGGTGG + Intergenic
1087501423 11:98959409-98959431 CTTTGAGAGGACAAGGCGGGTGG + Intergenic
1088245300 11:107812510-107812532 CTTTAAGAAAAAAAAGAGGGAGG + Intronic
1088257622 11:107916028-107916050 CTTTGAGAGGCCAAGGAGGGAGG - Intronic
1089485332 11:118841205-118841227 CTTTCAGAGGCCAAGGAGGGTGG + Intergenic
1089550499 11:119272414-119272436 CATTAAGAGCAGAATGGGGCTGG - Intronic
1090021294 11:123131084-123131106 CTTTAAGAGCCCAAGGGGGGTGG - Intronic
1090562419 11:127946856-127946878 CTTTAGGAGGACAAGGCGGGAGG + Intergenic
1090777434 11:129977709-129977731 CTTTGGGAGCATGAGGAGGGTGG + Intronic
1090783411 11:130027389-130027411 CTTTAGGAGGCCAAGGAGGGAGG - Intergenic
1092394942 12:8117533-8117555 CTTTAAGAGCCCAAGCAGGCTGG - Intergenic
1092486452 12:8906605-8906627 CTTTAAGAGCCCAAGGCAGGCGG - Intergenic
1092991087 12:13900228-13900250 CTTTAGGAGGCCAAGGAGGGTGG + Intronic
1093033932 12:14315301-14315323 CTTTGAGAGGAGAAAGCGGGTGG + Intergenic
1093129239 12:15369806-15369828 CTTTGAGAGGCCAAGGAGGGTGG + Intronic
1093185074 12:16010613-16010635 GTTTATGAACAGAAGGAGAGAGG + Intronic
1093544229 12:20327172-20327194 CTATAAGAGAATAAGGAGGCCGG - Intergenic
1093604703 12:21075839-21075861 CTTTAAGAGCACCAAGAAGGAGG + Intronic
1094574692 12:31674469-31674491 CCTTAAAAGTAGAAGGAGAGAGG - Intronic
1095775837 12:46009182-46009204 CTTTAAGAGGCCAAGGTGGGAGG - Intergenic
1095809522 12:46356967-46356989 CTTTAGGAGGCCAAGGAGGGTGG - Intergenic
1096042983 12:48536233-48536255 ACTTGAGAGCAGAGGGAGGGAGG + Intergenic
1096086107 12:48866012-48866034 CTTTAAGAGAAAGAGAAGGGAGG - Intergenic
1096890525 12:54766293-54766315 CTTTGAGAGGCCAAGGAGGGAGG - Intergenic
1096981487 12:55730035-55730057 CCTTAAGAGCCCAAGGAGTGGGG - Intergenic
1097201123 12:57279557-57279579 CTTTAGGAGGCCAAGGAGGGAGG + Intronic
1097885595 12:64725751-64725773 CTTTAGGAGGCCAAGGAGGGGGG + Intronic
1098005752 12:65995229-65995251 CTTTGGGAGGACAAGGAGGGTGG - Intergenic
1098240280 12:68460218-68460240 CTTTAGGAGGCCAAGGAGGGAGG + Intergenic
1098952410 12:76654681-76654703 CTTTAGGAGGACAAGGTGGGCGG - Intergenic
1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG + Intergenic
1099272996 12:80536635-80536657 CCTTAAGAGCAGAAGGAGAAAGG + Intronic
1099457831 12:82885612-82885634 CTTTAAGAGGCAAAGGTGGGGGG - Intronic
1099567032 12:84264573-84264595 CTTTAAGAGGCCAAGGTGGGTGG + Intergenic
1100512544 12:95291019-95291041 CTTTGGGAGCCCAAGGAGGGAGG + Intronic
1100742538 12:97609357-97609379 TTTTAAGAAAATAAGGAGGGTGG - Intergenic
1101390594 12:104296347-104296369 CTTTAAGAGAACAATGAGGCTGG + Intronic
1101525680 12:105527073-105527095 CTTTAAAAGCAAAAGGATTGTGG - Intergenic
1101800987 12:108021786-108021808 CCTTCAGAGCACAGGGAGGGTGG + Intergenic
1102172018 12:110849453-110849475 TTCTAAAAGCAGAAGGAGAGAGG + Intronic
1102194563 12:111015805-111015827 CTTAAAGAACATAAGGAGGTCGG + Intergenic
1102367712 12:112353584-112353606 CTTTGGGAGAACAAGGAGGGTGG + Intronic
1102892729 12:116573165-116573187 CTTTAAGAGGTCAAGGTGGGAGG - Intergenic
1102899703 12:116626762-116626784 CTTTAGGAGGCCAAGGAGGGAGG + Intergenic
1103110835 12:118276759-118276781 CTTTAAGAGGCCAAGGCGGGTGG + Intronic
1103306898 12:119972317-119972339 CTTTAGGAGCTCAAGGTGGGCGG + Intergenic
1103388281 12:120551227-120551249 CTTTAGGAGGCCAAGGAGGGAGG - Intronic
1103692702 12:122788389-122788411 CTATAATAGCAGCAAGAGGGTGG - Intronic
1104263981 12:127213173-127213195 CTTTGAGAGGCCAAGGAGGGTGG - Intergenic
1105595729 13:21836189-21836211 CTTTGAGAGGCCAAGGAGGGTGG - Intergenic
1105972053 13:25438398-25438420 CTTTGAGAGGCCAAGGAGGGAGG + Intronic
1106680783 13:32004883-32004905 TTTTAAGAGCAGAAGTCAGGAGG + Intergenic
1107656608 13:42598088-42598110 CTTTAAGAGGTCAAGGTGGGAGG - Intronic
1107659840 13:42627367-42627389 ATTTAATAAGAGAAGGAGGGAGG + Intergenic
1108214285 13:48168776-48168798 CTTTAGGAGACCAAGGAGGGTGG + Intergenic
1108730662 13:53232127-53232149 CATAAAGAGAAGAAGGAGGCGGG + Intergenic
1109510289 13:63363150-63363172 CTTTGAGAGGCCAAGGAGGGTGG + Intergenic
1109512664 13:63400249-63400271 CTTTAGGAGCCCAAGGCGGGTGG + Intergenic
1110296527 13:73872708-73872730 TTTTAAGAGCAGATGGAGCAAGG - Intronic
1110473357 13:75885542-75885564 CTTTCAGAGGCCAAGGAGGGTGG - Intergenic
1110718894 13:78739269-78739291 CTTTAAGAGGATGAGGCGGGAGG - Intergenic
1111021977 13:82462081-82462103 CTTTGAGAGGACAAGGCGGGTGG + Intergenic
1111241107 13:85476179-85476201 CTTAAAGAGCACATGGTGGGCGG + Intergenic
1111601100 13:90475637-90475659 CTTTAGGAGGCCAAGGAGGGTGG + Intergenic
1111937977 13:94576857-94576879 CTTTCAGAGGCCAAGGAGGGCGG + Intronic
1111990633 13:95113187-95113209 CTTTTAGGGGGGAAGGAGGGAGG - Intronic
1112049409 13:95631157-95631179 ATTTAAGATCAGAATGAGGTCGG + Intronic
1112107819 13:96260881-96260903 CTTTGAGAGGCCAAGGAGGGCGG - Intronic
1113057212 13:106281769-106281791 CTTTAAGAAAAGAAGGCGGCCGG + Intergenic
1113072475 13:106434902-106434924 CTTTGGGAGATGAAGGAGGGTGG - Intergenic
1113196070 13:107808033-107808055 CTTTAAGAGAAAAATGAGGAGGG + Intronic
1113213586 13:108011685-108011707 CTTTGAGAGCCCAAGGTGGGTGG - Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113436432 13:110295667-110295689 CTTTAAGAGGACGAGGCGGGTGG - Intronic
1113797100 13:113064870-113064892 CTTTCAGGGCAGCAGGAGGTGGG + Intronic
1113859982 13:113475641-113475663 CTTTGAGAGGTGGAGGAGGGAGG + Intronic
1114298407 14:21351594-21351616 CTTTAAGAGAAGAAGGGGGGAGG - Exonic
1114471220 14:22963991-22964013 CTTTGAGAGGCCAAGGAGGGCGG - Intronic
1114578142 14:23731662-23731684 CTTTATGAGCAGAAGAAAGAAGG - Intergenic
1114662802 14:24358878-24358900 CTTTAGGAGGCCAAGGAGGGCGG + Intergenic
1115671128 14:35612779-35612801 CTTTAGGAGGCCAAGGAGGGCGG - Intronic
1115686048 14:35797600-35797622 CTTTGAGAGGCCAAGGAGGGCGG + Intronic
1115829229 14:37316272-37316294 CTTTGAGAGCCCAAGGCGGGTGG - Intronic
1116620567 14:47197665-47197687 CTTTGAGAGGCCAAGGAGGGTGG + Intronic
1117047973 14:51832034-51832056 CTTTAAGAGGCCAAGGTGGGAGG + Intronic
1117704643 14:58451924-58451946 CTTTGAGAGCCCAAGGTGGGTGG - Intronic
1118384284 14:65242786-65242808 CTTAGAGGGCAGGAGGAGGGAGG + Intergenic
1119052264 14:71381293-71381315 CTTTGGGAGGACAAGGAGGGCGG - Intronic
1119122654 14:72093485-72093507 CTTTAGGAGGCCAAGGAGGGAGG - Intronic
1119209233 14:72817411-72817433 CTTTAAGAGGCCAAGGTGGGTGG + Intronic
1119726654 14:76925518-76925540 CTTTGAGAGGACAAGGCGGGTGG + Intergenic
1119728561 14:76937019-76937041 CTTTAAGAGGACAAGGCTGGTGG - Intergenic
1119898363 14:78239568-78239590 CTTGAAGAACAGCAGGAGGTAGG - Intergenic
1120097910 14:80409830-80409852 GTTTAAGAGGAAAAGGAGGAAGG - Intergenic
1120837015 14:89048983-89049005 CTTTGAGAGTCCAAGGAGGGAGG + Intergenic
1121466977 14:94122127-94122149 CTTTAATAGCAGCAGGAGTGGGG - Intergenic
1121470886 14:94153462-94153484 CTTTAAGAGGCCAAGGCGGGTGG + Intronic
1121542229 14:94737018-94737040 CCTTAAGAGAAGAAGCAGAGAGG + Intergenic
1121643906 14:95504735-95504757 CTTTGAGAGGCCAAGGAGGGAGG + Intergenic
1121744106 14:96274538-96274560 CTTTATGAAATGAAGGAGGGAGG + Intergenic
1122386281 14:101350476-101350498 TTTTCTGAGCAGCAGGAGGGTGG - Intergenic
1123667409 15:22618529-22618551 CTTTGAGAGCCCAAGGTGGGTGG + Intergenic
1123773477 15:23553798-23553820 CTTTCAGGGGAAAAGGAGGGGGG - Intergenic
1124321252 15:28713094-28713116 CTTTGAGAGCCCAAGGTGGGTGG + Intronic
1124357264 15:29004921-29004943 CTTTGAGAGCCCAAGGCGGGTGG - Intronic
1124449016 15:29767810-29767832 CTTTGAGACCAGAAGGAAAGAGG - Intronic
1124481244 15:30082258-30082280 CTTTGAGAGCCCAAGGTGGGTGG - Intergenic
1124487699 15:30134354-30134376 CTTTGAGAGCCCAAGGTGGGTGG - Intergenic
1124522353 15:30414934-30414956 CTTTGAGAGCCCAAGGTGGGTGG + Intergenic
1124755830 15:32403967-32403989 CTTTGAGAGCCCAAGGTGGGTGG + Intergenic
1124762340 15:32456308-32456330 CTTTGAGAGCCCAAGGTGGGTGG + Intergenic
1124776291 15:32592762-32592784 CTTTGAGAGCCCAAGGTGGGTGG - Intergenic
1124787088 15:32691722-32691744 CTTTACGAGAAGATGAAGGGAGG + Exonic
1125258733 15:37798006-37798028 CTTTGAGAGGGGAAGGAGGCTGG - Intergenic
1125403253 15:39326752-39326774 AGTTATGAGCAGATGGAGGGAGG - Intergenic
1125587473 15:40831020-40831042 CTTCCTGAGCAGGAGGAGGGGGG + Intergenic
1125888176 15:43244822-43244844 CTTTGAGAGGCCAAGGAGGGAGG + Intronic
1125892117 15:43274548-43274570 CTTTGAGAGGCCAAGGAGGGCGG + Intergenic
1125898113 15:43319694-43319716 CTTTGGGAGCACAAGGAGGGAGG - Intergenic
1125924999 15:43555847-43555869 CTTTGAGAGGCCAAGGAGGGTGG - Intronic
1126700477 15:51362239-51362261 CTTTGGGAGTAGAAGGCGGGCGG + Intronic
1127564981 15:60178577-60178599 CTTTCAAAGCAGTATGAGGGGGG + Intergenic
1127631997 15:60836271-60836293 CTTTATGTGCAGATGGAGAGAGG + Intronic
1128268476 15:66288322-66288344 CTTTAGGAGGACAAGGTGGGAGG + Intergenic
1128296037 15:66520362-66520384 CTTTAGGAGGCCAAGGAGGGAGG - Intronic
1128637604 15:69313253-69313275 CTTTCAGAGGCCAAGGAGGGAGG + Intronic
1128904177 15:71452455-71452477 CTTTGAGAGCTGAGGGAGGAGGG - Intronic
1129754742 15:78091121-78091143 CTTTGGGAGCACAAGGTGGGAGG - Intronic
1129821503 15:78605172-78605194 ATTTAAGAACAGAAGTGGGGTGG + Intronic
1129862287 15:78872421-78872443 CTTTAGGATCAGCAAGAGGGTGG - Intronic
1130079961 15:80724217-80724239 CTTTAATCCCAGAAGGTGGGAGG + Intronic
1130308868 15:82735377-82735399 GACTAAGAGCAGAAGGAGAGTGG - Intergenic
1130328338 15:82899777-82899799 CTTTAAGAGGCCAAGGTGGGCGG + Intronic
1130423466 15:83772148-83772170 CTATAAGAGCCAAAGGAGGCCGG - Intronic
1131648980 15:94378276-94378298 CTTTAAGAGGACAAGGAGGGAGG + Intronic
1131670765 15:94617304-94617326 CTTGGAGAGAGGAAGGAGGGGGG - Intergenic
1133054488 16:3138746-3138768 CTTTAAGAAGAGCAGGAGGCTGG - Exonic
1133247410 16:4458414-4458436 CTTTAGGAGGCCAAGGAGGGAGG + Intergenic
1133434409 16:5766788-5766810 CCTTGAGGGCAGAAGCAGGGTGG - Intergenic
1133652883 16:7829601-7829623 CTTTAAAAGAGGAAGGTGGGTGG - Intergenic
1133876608 16:9740777-9740799 ACTTCAGAGCAGAAGTAGGGAGG - Intergenic
1134501899 16:14775876-14775898 CTTTCAGAGGCCAAGGAGGGTGG - Intronic
1134578662 16:15353018-15353040 CTTTCAGAGGCCAAGGAGGGTGG + Intergenic
1134723926 16:16404527-16404549 CTTTCAGAGGCCAAGGAGGGTGG - Intergenic
1134811601 16:17171902-17171924 CTTTAGGAGAGGAAGGAGGCTGG + Intronic
1134943504 16:18307343-18307365 CTTTCAGAGGCCAAGGAGGGTGG + Intergenic
1135401888 16:22171773-22171795 CTTTGACAGCCGCAGGAGGGAGG - Intronic
1135568932 16:23533436-23533458 GTTTGAAAGTAGAAGGAGGGCGG - Intronic
1135678329 16:24436271-24436293 CTTTAAGAGGCCAAGGAAGGAGG + Intergenic
1135709358 16:24701826-24701848 CCATAAGACCAGAAGGAAGGAGG - Intergenic
1135821617 16:25691470-25691492 CTTCAAGAGAAGATGGGGGGCGG + Intergenic
1135957811 16:26970888-26970910 CTTTGAGAGGCCAAGGAGGGAGG + Intergenic
1136227462 16:28868697-28868719 CTTTGAGAGGCCAAGGAGGGTGG - Intronic
1136351950 16:29716198-29716220 CTTTAGGAGGCTAAGGAGGGTGG + Intergenic
1136867922 16:33771061-33771083 ATGTGAGAGAAGAAGGAGGGCGG + Intergenic
1137412105 16:48237522-48237544 ATTTAAGATCAAAAGCAGGGAGG - Intronic
1137462788 16:48680529-48680551 CATTGGGAGCAGAAGGAAGGTGG - Intergenic
1137797258 16:51232492-51232514 CTTTAAGAGGCCAAGGCGGGTGG - Intergenic
1138371439 16:56530242-56530264 CTTTAAGAGGCCAAGGTGGGTGG + Intergenic
1138439921 16:57028072-57028094 CTTTAAGAGCAGGAAGTGTGGGG + Exonic
1138488967 16:57365043-57365065 CTTTGGGAGCACAAGGAAGGTGG - Exonic
1139453581 16:67052716-67052738 CTTTCAGAGGTTAAGGAGGGAGG + Intronic
1140105650 16:71957552-71957574 CTTTGGGAGGAGAAGGTGGGAGG + Intronic
1140185568 16:72767293-72767315 CTTTGGGAGCCCAAGGAGGGAGG - Intergenic
1140826307 16:78709972-78709994 CTTTGGGAGGACAAGGAGGGTGG - Intronic
1141500996 16:84443921-84443943 CTTTAAGAGGCTAAGGCGGGAGG + Intronic
1141585320 16:85029640-85029662 CTTTATGAGAGAAAGGAGGGAGG - Intronic
1141870295 16:86780666-86780688 CTTTCAGAGGCCAAGGAGGGTGG + Intergenic
1203104255 16_KI270728v1_random:1345217-1345239 ATGTGAGAGAAGAAGGAGGGCGG - Intergenic
1203129259 16_KI270728v1_random:1617151-1617173 ATGTGAGAGAAGAAGGAGGGCGG + Intergenic
1142664031 17:1451473-1451495 CTTTGAGAGGCCAAGGAGGGTGG - Intronic
1143169388 17:4918738-4918760 CTTTAAGAGGCCGAGGAGGGTGG + Intergenic
1143274459 17:5699834-5699856 CTGCAAGAAAAGAAGGAGGGGGG + Intergenic
1143444244 17:6997801-6997823 CTTTGAGAGGCCAAGGAGGGCGG - Intronic
1143643359 17:8212929-8212951 CTTCAGGAGCCCAAGGAGGGTGG + Intergenic
1143916196 17:10295180-10295202 CTAGAAGAGCAGAGGGAAGGAGG - Intergenic
1144032308 17:11333789-11333811 CTTTAGGAGGCCAAGGAGGGTGG + Intronic
1144260476 17:13514638-13514660 CTTTGAGAGGACAAGGAGGGTGG + Intronic
1144463421 17:15477438-15477460 CTATTACAGCAGAAGGAGGAAGG - Intronic
1144626630 17:16847282-16847304 GTTCAAGAGCAGAAGGAGAGGGG - Intergenic
1144660940 17:17070525-17070547 GCTTAAGAGCAGAAGGATTGGGG - Intronic
1144879802 17:18425429-18425451 GTTCAAGAGCAGAAGGAGAGGGG + Intergenic
1145152432 17:20518955-20518977 GTTCAAGAGCAGAAGGAGAGGGG - Intergenic
1145360626 17:22209156-22209178 CTTTAGGAGCCCAAGGTGGGAGG + Intergenic
1146091056 17:29878182-29878204 CTTTCAGAGGCCAAGGAGGGCGG + Intronic
1146144252 17:30397932-30397954 CTTTAAGAGGCCAAGGTGGGAGG + Intronic
1146163775 17:30573160-30573182 GTTCAAGAGCAGAAGGAGAGGGG - Intergenic
1146174889 17:30659568-30659590 CTTTAAGAGACGGAGGTGGGTGG + Intergenic
1146203510 17:30881544-30881566 CTTTAAGAGGCCAAGGTGGGTGG - Intronic
1146348345 17:32075592-32075614 CTTTAAGAGACGGAGGTGGGTGG + Intergenic
1146366024 17:32228584-32228606 CTTTAGGAGACGAAGGCGGGCGG + Intronic
1146401942 17:32506489-32506511 CTCTCAGAGCAGTAGAAGGGAGG + Intronic
1146578891 17:34019149-34019171 CTTTGAGAGGCCAAGGAGGGCGG - Intronic
1147437093 17:40423223-40423245 CTTTCCCAGCAGAAGGAGGCTGG + Intergenic
1147580771 17:41625972-41625994 GTTCAAGAGCAGAAGGAGAGGGG - Intergenic
1147657578 17:42099277-42099299 CTTTGAGAGGAGGAAGAGGGGGG + Intergenic
1147710453 17:42459552-42459574 ATTAAAGAGCAGGAGGACGGAGG + Intronic
1148113673 17:45162165-45162187 CTTTCTGAGAGGAAGGAGGGAGG + Intronic
1148275686 17:46300354-46300376 CTTTAAGAGGCCAAGGTGGGAGG - Intronic
1148297796 17:46517930-46517952 CTTTAAGAGGCCAAGGTGGGAGG - Intronic
1148362344 17:47022411-47022433 CTTTAAGAGGCCAAGGTGGGAGG - Intronic
1148451288 17:47779446-47779468 CTTTGGGAGCCCAAGGAGGGAGG + Intergenic
1148885584 17:50769980-50770002 CTTTAGGAGGCCAAGGAGGGCGG - Intergenic
1149126258 17:53237393-53237415 CTTTAAGAAGCCAAGGAGGGAGG + Intergenic
1149452587 17:56761362-56761384 CTCGAAGAGCAGAAGTAGGCTGG - Intergenic
1149828293 17:59849411-59849433 CTTTAAGAGGATGAGGTGGGAGG + Intergenic
1149990727 17:61382082-61382104 CTTTGAGAGGCTAAGGAGGGTGG + Intronic
1150112397 17:62513577-62513599 CTTTGAGAGCATGAGGTGGGAGG - Intronic
1150324873 17:64248789-64248811 CTTTAGGAGGCCAAGGAGGGTGG + Intronic
1150404790 17:64892010-64892032 CTTTAAGAGGCCAAGGTGGGAGG + Intronic
1150472424 17:65448474-65448496 CTGTAAGATAAGAATGAGGGTGG + Intergenic
1150736824 17:67747795-67747817 CTTTCATAGCTGAAGGAAGGAGG + Intergenic
1150979236 17:70122998-70123020 ATTTAAGAGCAGAAGGAGGGAGG - Intronic
1151400844 17:73855090-73855112 CTTTGAGAGGCCAAGGAGGGCGG - Intergenic
1151490247 17:74428570-74428592 CTTTGGGAGGACAAGGAGGGAGG + Intronic
1151934933 17:77255706-77255728 CTTTCAGGGCAGAGGCAGGGTGG + Intergenic
1152110326 17:78354090-78354112 CTTTAAGAGGACGAGGTGGGCGG + Intergenic
1152390227 17:79999785-79999807 CTTTGAGAGCCCAAGGCGGGCGG - Intronic
1152413508 17:80143733-80143755 CTTTAGGAGGCCAAGGAGGGTGG + Intronic
1152653349 17:81507067-81507089 CTTTAGGAGGCCAAGGAGGGTGG + Intergenic
1152763826 17:82124547-82124569 CTTTGAGAGCGTAAGGTGGGAGG + Intronic
1152774170 17:82189604-82189626 CTTTAGGAGGCCAAGGAGGGTGG + Intronic
1153170823 18:2313996-2314018 CATTGAGAGGTGAAGGAGGGAGG + Intergenic
1153691347 18:7597096-7597118 CTTTAGAAGGACAAGGAGGGTGG - Intronic
1153915038 18:9737865-9737887 TTTTAAAAGCAGAAGGGGGTGGG - Intronic
1154074731 18:11188913-11188935 CGATGAGAGCAGAAGGTGGGAGG + Intergenic
1154210459 18:12375475-12375497 CTTTGAGAGGAGGAGGCGGGAGG + Intronic
1154405335 18:14085437-14085459 CTTTAAGAGAGGAAGGGGTGAGG + Intronic
1155383127 18:25246615-25246637 CTTTAAGAGAGGGTGGAGGGTGG - Intronic
1155539883 18:26858025-26858047 CTTTAAGAGGCCAAGGTGGGTGG + Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155571332 18:27197162-27197184 CTTTAAGAGGCTAAGGTGGGAGG + Intergenic
1155615356 18:27715725-27715747 CTGTAACATCAGAAGTAGGGAGG - Intergenic
1155779274 18:29811040-29811062 CATTGAGAGTGGAAGGAGGGAGG + Intergenic
1155971203 18:32085454-32085476 CTTTAAGAGGCCAAGGTGGGAGG + Intergenic
1156420218 18:36944333-36944355 CTTTAGGAGGACAAGGCGGGCGG + Intronic
1156777512 18:40810625-40810647 CTTTATGAGCAGAAGTGGAGGGG + Intergenic
1156821215 18:41375491-41375513 CTTTAGGAGGCTAAGGAGGGAGG + Intergenic
1156988719 18:43380253-43380275 CTTTGAGAGGCCAAGGAGGGTGG - Intergenic
1157161118 18:45315375-45315397 CTTACCCAGCAGAAGGAGGGTGG + Intronic
1157255394 18:46134172-46134194 CTTTAGGAGGCCAAGGAGGGTGG + Intergenic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1158619286 18:59017524-59017546 ATATAAAAACAGAAGGAGGGTGG - Intergenic
1158790432 18:60774380-60774402 CATTAAGAGTAGACAGAGGGAGG + Intergenic
1158865425 18:61633685-61633707 CTTTAGGAGGCCAAGGAGGGTGG + Intergenic
1159580420 18:70229498-70229520 CTTTAGGAGGTGAAGGTGGGAGG + Intergenic
1159708173 18:71718691-71718713 CTTTGGGAGGACAAGGAGGGTGG - Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1161064103 19:2229123-2229145 CTTTGAGACCAGAAGGAAGTTGG + Intronic
1161365150 19:3874696-3874718 CTTTGAGAGGATGAGGAGGGCGG + Intergenic
1161530140 19:4783823-4783845 CTTTGGGAGGAGAAGGAGGGAGG + Intergenic
1161656816 19:5521352-5521374 CTTTGAGAGGCCAAGGAGGGAGG + Intergenic
1161720321 19:5898628-5898650 CTTTAAGAGGCCAAGGTGGGCGG + Intronic
1161799206 19:6406326-6406348 CTTTAAGAGGCCAAGGTGGGTGG - Intergenic
1161908485 19:7175268-7175290 CTTTGAGAGGCCAAGGAGGGAGG + Intronic
1162208454 19:9073486-9073508 CTTTAGGAGGCCAAGGAGGGTGG + Intergenic
1162539004 19:11282347-11282369 CTTTAGGAGGCAAAGGAGGGCGG - Intergenic
1162542476 19:11306022-11306044 CTTTGGGAGGACAAGGAGGGTGG + Intronic
1162858584 19:13488641-13488663 CTTTAAGAGGCCAAGGCGGGTGG - Intronic
1162876487 19:13624441-13624463 CTTAAAGAGCAGAGGAACGGTGG + Intergenic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1163119019 19:15205009-15205031 CTTTGAGAGGCCAAGGAGGGAGG + Intergenic
1163147657 19:15392075-15392097 CTTTAGGAGGTGAAGGTGGGAGG - Intronic
1163395365 19:17057104-17057126 CTTTCAGAGGCTAAGGAGGGCGG + Intronic
1163475917 19:17526068-17526090 CTTTAGGAGGTCAAGGAGGGTGG + Intronic
1163781891 19:19254868-19254890 CTTTAAGAGACCAAGGTGGGAGG - Intergenic
1163926762 19:20353261-20353283 TTTTAAGAGCACACAGAGGGGGG - Intergenic
1163933290 19:20419688-20419710 CTTTGAGGGGACAAGGAGGGTGG + Intergenic
1164216691 19:23156825-23156847 CTTTGAGAGGCCAAGGAGGGCGG + Intergenic
1164468037 19:28504947-28504969 CCTCTAGAGCAGAAGGTGGGAGG - Intergenic
1164916315 19:32055036-32055058 CTTTCAGAGTCCAAGGAGGGAGG + Intergenic
1164973562 19:32552947-32552969 CTTTGAGAGGTGAAGGTGGGAGG + Intergenic
1165455993 19:35910972-35910994 CTTTAGGAGGCCAAGGAGGGTGG + Intergenic
1166229202 19:41415888-41415910 CTTTAGGAGGTGGAGGAGGGCGG - Intronic
1166325418 19:42047294-42047316 CTTTAAGAGGCCAAGGAGGGAGG + Intronic
1166599131 19:44078701-44078723 CTTTAAGAGGCTAAGGTGGGGGG - Intronic
1166613063 19:44217205-44217227 CTTTAGGAGGCCAAGGAGGGAGG - Intronic
1167014637 19:46832822-46832844 CTTTGGGAGCAGGAGGGGGGTGG + Intergenic
1167084955 19:47303090-47303112 CTTTGAGAGGCCAAGGAGGGAGG - Intronic
1167513823 19:49911143-49911165 CTTTGAGAGGACAAAGAGGGAGG - Intronic
1167653084 19:50744043-50744065 CTTTGAGAGGTCAAGGAGGGAGG + Intergenic
1167664478 19:50815932-50815954 CTTTGAGAGGCCAAGGAGGGAGG + Intergenic
1167898204 19:52598663-52598685 CTTTGAGAGGCCAAGGAGGGAGG + Intronic
1168229346 19:55019350-55019372 CTTTGAGAGGCCAAGGAGGGTGG - Intronic
925083293 2:1087056-1087078 GCTAAGGAGCAGAAGGAGGGTGG + Intronic
925615419 2:5740615-5740637 CTTTGAGAGCAGAAGGTGAGCGG - Intergenic
925788602 2:7457972-7457994 CTTTGAGAGGCCAAGGAGGGTGG - Intergenic
925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG + Intergenic
925962666 2:9033290-9033312 TTTCAAGAGGAGAAGGAGGTAGG - Intergenic
926084013 2:10009901-10009923 CTTTCCAAGCAGGAGGAGGGAGG + Intergenic
926142942 2:10379256-10379278 ATTTACAAGCAGAAAGAGGGAGG - Intronic
927078847 2:19608040-19608062 CTTTAAGACCAGGACGAGGCTGG - Intergenic
927139175 2:20118159-20118181 CTGGAAGATCAGGAGGAGGGTGG + Intergenic
927144919 2:20157272-20157294 CTTTGAAAGGAGCAGGAGGGAGG + Intergenic
927536515 2:23865283-23865305 CTTTGGGAGCCCAAGGAGGGCGG + Intronic
928006333 2:27565458-27565480 CTTAAATAGCAGGTGGAGGGAGG + Intronic
928276571 2:29906112-29906134 CTTTAAGAGGAGAGGGCGTGTGG + Intronic
928554108 2:32404903-32404925 CTTTGGGAGGACAAGGAGGGAGG - Intronic
928734942 2:34277615-34277637 CTTTTAGAGGCCAAGGAGGGCGG + Intergenic
929461971 2:42108996-42109018 CTTTGAGAGACCAAGGAGGGAGG + Intergenic
929508038 2:42543727-42543749 CTTTAGGAGGCCAAGGAGGGAGG - Intronic
930243450 2:48959426-48959448 CTGCAAGAGCAAATGGAGGGAGG - Intergenic
930791145 2:55330252-55330274 CTTTCAGAGGACAAGGTGGGTGG + Intronic
931330059 2:61271560-61271582 CTTTAAAAGGAGAAGAAAGGAGG + Intronic
932004955 2:67918599-67918621 CTTTGAGAGGCCAAGGAGGGAGG + Intergenic
932042174 2:68311528-68311550 CTTTGAGAGGACAAGGTGGGCGG + Intronic
932168538 2:69531866-69531888 CTTTAAGTGAAGAATGAGGAGGG - Intronic
932244361 2:70184052-70184074 CTTTAAGAGGACAAGGCAGGAGG - Intronic
932312589 2:70755701-70755723 TTTTATGAGGAGAGGGAGGGAGG - Intronic
933319712 2:80758008-80758030 CATTGAGAGTAGATGGAGGGAGG - Intergenic
933535623 2:83570010-83570032 CTTAAAGGGCAGAAAGAGAGAGG - Intergenic
933638639 2:84735045-84735067 CTGAAAGAGCAGATGGAGGGAGG - Intronic
934960900 2:98671805-98671827 CTTTATGAAAGGAAGGAGGGAGG + Intronic
935575895 2:104710155-104710177 CCTTAAGAGAAGAGGGTGGGTGG - Intergenic
935956856 2:108385562-108385584 CTCTAGGAGCAGAGGGCGGGTGG - Intronic
936690269 2:114879170-114879192 ATTTCAGAGAAGAAGTAGGGAGG - Intronic
937150394 2:119682227-119682249 CTTTGAGAGCCTGAGGAGGGTGG - Intronic
937208033 2:120249274-120249296 CTTTAGGAGGTGAAGGTGGGTGG - Intronic
937936883 2:127253045-127253067 CTTTAGGAGGACAAGGCGGGCGG + Intergenic
938115449 2:128600157-128600179 TTTTAAGGGCAGAAGGAAGGAGG + Intergenic
938235618 2:129704166-129704188 CCAGAAGAGGAGAAGGAGGGAGG - Intergenic
939280653 2:140059596-140059618 CTTTGAGAGACCAAGGAGGGCGG - Intergenic
939559106 2:143712898-143712920 CTCTAAGAGCAGAAGAAGCCAGG - Intronic
939574056 2:143874750-143874772 CTTGAAGAGCAGAAGCCAGGCGG - Intergenic
939671057 2:145013031-145013053 CTTTGCGAGCAGGAAGAGGGAGG - Intergenic
939756654 2:146121583-146121605 CTTTAGGAGACCAAGGAGGGCGG + Intergenic
940092728 2:149938944-149938966 GCTGCAGAGCAGAAGGAGGGAGG - Intergenic
940211495 2:151260332-151260354 CTTTGGGAGGCGAAGGAGGGCGG - Intronic
940225034 2:151392360-151392382 CTTTGAGAGGCCAAGGAGGGCGG - Intergenic
940535451 2:154935424-154935446 CATTGAGAGCAGACAGAGGGAGG - Intergenic
940540113 2:155003689-155003711 CTTTAGGAGGCCAAGGAGGGTGG - Intergenic
940866308 2:158820813-158820835 CTTTATAAGGAGAAGAAGGGAGG + Intronic
941380227 2:164783722-164783744 CTTTAGGAGGCCAAGGAGGGAGG + Intronic
941433637 2:165441265-165441287 CTTTGAGAGTACAAGGCGGGAGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942737050 2:179126438-179126460 CTTTAAGTGCAAAAAGAGGGAGG - Intronic
942738710 2:179147601-179147623 CTTTAGGAGGACAAGGCGGGTGG - Intronic
943663371 2:190583179-190583201 CTTGATGGGCAGAAGGAGAGAGG + Intergenic
945099937 2:206254430-206254452 CTTTAGGAGGACAAGGCGGGTGG - Intergenic
945167085 2:206957683-206957705 CTTTCAGAGCGGTAGGTGGGTGG - Intronic
945586051 2:211664430-211664452 CTTTATGGGCAGTAGGAGGATGG + Intronic
945842364 2:214903299-214903321 TTTTAAGAGGAGGTGGAGGGAGG + Intergenic
945856664 2:215077022-215077044 CTTCAGGAACAGAAGGAAGGAGG + Intronic
946863435 2:224021778-224021800 CTTTAAGAGGCCAAGGTGGGTGG + Intronic
947109004 2:226698570-226698592 CTTTGAGAGGCCAAGGAGGGCGG - Intergenic
947453978 2:230236242-230236264 CTGTAACTGCAAAAGGAGGGTGG - Intronic
947536385 2:230942627-230942649 CCAAAAGAGCAGAGGGAGGGTGG + Intronic
947600578 2:231446498-231446520 CTTTGGGAGGATAAGGAGGGAGG + Intergenic
947738279 2:232470924-232470946 CTTTGAGAGGCCAAGGAGGGAGG - Intergenic
948152848 2:235757975-235757997 CTTTAACAGCACAAGGACTGTGG - Intronic
948478460 2:238236260-238236282 CTTTAAAAGTAGAAGTAAGGAGG + Intergenic
948654868 2:239470345-239470367 CATAAAGAGCAGAAAGAGGCTGG - Intergenic
948931869 2:241137199-241137221 CTTTAAGCTCAGAGGGAAGGTGG + Exonic
948973754 2:241449753-241449775 CTTTGGGAGGCGAAGGAGGGTGG + Intronic
1169390815 20:5189453-5189475 CTTTAAGAGGCCAAGGCGGGAGG + Intronic
1169399318 20:5266319-5266341 CTTTGAGAGGATAAGGCGGGTGG + Intergenic
1169431368 20:5539280-5539302 CTTTCAGAGGGGAAGGTGGGTGG + Intergenic
1169438486 20:5614088-5614110 CTTTGGGAGGTGAAGGAGGGCGG + Intergenic
1169749176 20:8974221-8974243 CTTTGAGAGGCCAAGGAGGGAGG - Intergenic
1169941492 20:10942600-10942622 ATTGAAGAGCAGAGGGAGGAAGG - Intergenic
1170139425 20:13110913-13110935 CTTTAAGACAAGGAGGAGTGTGG + Intronic
1170247629 20:14240685-14240707 ACTTGAGGGCAGAAGGAGGGAGG + Intronic
1170307505 20:14955796-14955818 CTTACAGAGCTGAAGGAGAGAGG + Intronic
1170744942 20:19090997-19091019 CCTTAAGAGAAGAAGGAGAGAGG + Intergenic
1170761596 20:19255850-19255872 CTTTAAGAGGCCAAGGAGGGAGG + Intronic
1172553068 20:35817031-35817053 CTTTGGGAGGACAAGGAGGGTGG - Intronic
1172671601 20:36638132-36638154 CTTTAAGAGGCTGAGGAGGGCGG - Intronic
1173719082 20:45237471-45237493 CTTAAAGGCCAGAAGGAGAGTGG - Intergenic
1173826538 20:46051421-46051443 CTGTATGAGCAGTGGGAGGGTGG + Intronic
1173914701 20:46698338-46698360 CCTTAAAAGTAGAAGGAGGCAGG - Intergenic
1174474323 20:50785432-50785454 CTTTAGGAGGCCAAGGAGGGAGG - Intergenic
1174621448 20:51877840-51877862 CTTTAAGAGCCCAAGGCGGAAGG + Intergenic
1174838443 20:53879499-53879521 CTTTAGGAGGTGGAGGAGGGTGG + Intergenic
1174901632 20:54506702-54506724 CTTTGAGAGGCCAAGGAGGGAGG - Intronic
1175090535 20:56499977-56499999 CTTTGAGAGGCCAAGGAGGGTGG - Intronic
1175227457 20:57452904-57452926 GTGTAAGGGCAGAAAGAGGGAGG + Intergenic
1175358940 20:58391774-58391796 CTTTGAGAGGCCAAGGAGGGCGG - Intronic
1175370143 20:58482861-58482883 CTGTAAGTGCAGATGGAAGGAGG - Intronic
1176719394 21:10380836-10380858 CTTTGAGAGCCCAAGGCGGGTGG - Intergenic
1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG + Intergenic
1177252650 21:18614419-18614441 CTTTAATATCAGCAGGAGAGAGG + Intergenic
1177709233 21:24749884-24749906 CTTTAAGAGCTGAAGGATAAAGG - Intergenic
1177880993 21:26694807-26694829 CTTTGAGAGGCCAAGGAGGGCGG + Intergenic
1178061301 21:28856169-28856191 CTTTAGGAGGCCAAGGAGGGTGG + Intergenic
1178064258 21:28886438-28886460 CTTTGAGAGCCCAAGGCGGGTGG - Intergenic
1178070508 21:28960819-28960841 CTTCAGGAGGAGGAGGAGGGGGG - Intronic
1178084860 21:29102558-29102580 CTTTGAGAGGCGGAGGAGGGAGG - Intronic
1178354585 21:31900016-31900038 CTTTGGGAGCCCAAGGAGGGTGG - Intronic
1178784800 21:35643516-35643538 CTTTAAGAGGCCAAGGCGGGCGG + Intronic
1179085977 21:38218144-38218166 CTTTGAGAGGACAAGGAAGGAGG + Intronic
1180216607 21:46327507-46327529 CTTTAAGAGGCTGAGGAGGGAGG - Intronic
1180300619 22:11033764-11033786 CTTTGAGAGCCCAAGGCGGGTGG - Intergenic
1181282703 22:21731132-21731154 CTTTAAGAGGCCAAGGTGGGAGG + Intronic
1181746648 22:24959697-24959719 CTGTACGAGAAGAAGGAAGGGGG + Intronic
1182607322 22:31516267-31516289 CTTTGAGAGGCCAAGGAGGGTGG + Intronic
1182640077 22:31759977-31759999 CTTTAAAACCAGAAAGAGGCTGG - Intronic
1183330640 22:37219036-37219058 CAGCAAGAGCAGATGGAGGGTGG - Intergenic
1183449336 22:37883051-37883073 CTTTGAGAGGCGAAGGTGGGCGG + Intronic
1183717746 22:39543751-39543773 CTTTCTGAGCAGGAGGAGTGGGG - Intergenic
1183790814 22:40067687-40067709 GTTCAAGAGCAGGAGGAGGAGGG + Intronic
1184223623 22:43116382-43116404 CTTTAAGAGCACAAGGCGAAAGG - Intronic
1184613290 22:45619866-45619888 CTTTAAGAGGCCAAGGTGGGAGG - Intergenic
1184857580 22:47154815-47154837 CTTTAGGAGCAGAAGCAGCCTGG + Intronic
1185121418 22:48973879-48973901 CTGGAAGAGCAGTAGGAGGGAGG - Intergenic
1185184010 22:49381767-49381789 AGTTAACAGGAGAAGGAGGGCGG - Intergenic
949108697 3:231818-231840 CTTTGAGAGGCCAAGGAGGGTGG - Intronic
949136010 3:566456-566478 CTTTGAGAGCCCAAGGTGGGCGG + Intergenic
949588656 3:5469249-5469271 CTTTAAGGACTAAAGGAGGGTGG + Intergenic
951158384 3:19383614-19383636 CTTTAAGAGGCCAAGGCGGGTGG - Intronic
951186558 3:19720669-19720691 CTTTAGGAGGTGAAGGTGGGAGG + Intergenic
951223284 3:20092471-20092493 CTTTAGGAGGACAAGGTGGGTGG - Intronic
951797470 3:26556566-26556588 CTTTGAGAGGACAAGGTGGGTGG + Intergenic
952079620 3:29742226-29742248 CTTTAGGAACTGAGGGAGGGTGG + Intronic
952274896 3:31867496-31867518 CTTTGGGAGCCCAAGGAGGGTGG + Intronic
952349872 3:32523940-32523962 CTTTAGGAGGCGGAGGAGGGCGG + Intergenic
952767283 3:36965256-36965278 CTTTGGGAGGACAAGGAGGGAGG + Intergenic
952836190 3:37604207-37604229 CTTTAAATGGAGAAGGAGTGGGG + Intronic
953054990 3:39380973-39380995 CTGTCAGAGCAGGAGGAGGTGGG - Intergenic
953271389 3:41448641-41448663 CTGTAAGGGCAGGAGGATGGTGG + Intronic
953405728 3:42658920-42658942 TTTAAGGAGGAGAAGGAGGGTGG + Exonic
954288373 3:49635729-49635751 CTTTGAGAGGCGAAGGTGGGAGG + Intronic
954443627 3:50535079-50535101 CTTGAGGAGCAGAATGGGGGAGG - Intergenic
954470318 3:50688705-50688727 CTTTAAGAGGCCAAGGTGGGTGG - Intronic
954837528 3:53482739-53482761 CTTTGAGAGGACAAGGTGGGAGG + Intergenic
954892405 3:53943246-53943268 CTTTGAGAGGCCAAGGAGGGAGG + Intergenic
954917196 3:54158417-54158439 CTTTAAGAACAGTATGAGGTGGG + Intronic
955739986 3:62080370-62080392 GTTTAAGAACAGAAGGGGGCTGG - Intronic
956056362 3:65302859-65302881 CTTTAAGAGGTCAAGGAAGGAGG + Intergenic
956469062 3:69546086-69546108 CTTTAGGAGGACAAGGTGGGAGG - Intergenic
956656437 3:71557657-71557679 CTTGAAGAGCAGAAAGTCGGAGG - Intronic
956664987 3:71633545-71633567 CTTTGAGAGGCCAAGGAGGGTGG - Intergenic
956687248 3:71841476-71841498 CTTTAACAGCAGTAAGAAGGTGG + Intergenic
956814597 3:72896546-72896568 CATTAAAAGCTGAAGGAGTGTGG + Intronic
956820163 3:72947093-72947115 CTTTGGGAGCAGGAGGTGGGAGG - Intronic
957216087 3:77321271-77321293 CTTTAAGAGGTCAAGGTGGGAGG + Intronic
957540816 3:81566661-81566683 ATTTGAGAGCAAAAGGAGGAAGG - Intronic
958485711 3:94705274-94705296 CTTTGAGAGGCCAAGGAGGGTGG + Intergenic
959373817 3:105563047-105563069 CTTTAGGAGGCCAAGGAGGGCGG - Intronic
959491955 3:107001039-107001061 CTTTAAAACCTGAAGGATGGAGG + Intergenic
959945415 3:112120579-112120601 TTTTAAGACCAGCATGAGGGAGG + Intronic
960015826 3:112886201-112886223 CTTTGAGAGTGGATGGAGGGAGG - Intergenic
960297506 3:115961792-115961814 ATTTAAGAGCAGCAGGAGGGAGG - Intronic
961531330 3:127542188-127542210 CTCTCAGAGCAGGATGAGGGTGG - Intergenic
962767800 3:138581458-138581480 CTTTGAGAGGTGAAGGTGGGTGG + Intronic
964006267 3:151832970-151832992 CAAGAAGAGCAGGAGGAGGGAGG + Intergenic
964234364 3:154507529-154507551 CTTTGAGAGGTGAAGGTGGGAGG - Intergenic
964287122 3:155130386-155130408 GTTTGAGAGCATAAGGAGGCGGG + Intronic
964703068 3:159590330-159590352 CTTTCAGAGGCGAAGGTGGGAGG + Intronic
965584044 3:170299468-170299490 CTTTAAGAGGCCAAGGTGGGTGG - Intronic
965906577 3:173714981-173715003 CATAAAGAGCAGATGGAAGGAGG + Intronic
966195071 3:177304953-177304975 CTTAAAGATCAGAAGGAGGCCGG - Intergenic
966491679 3:180534342-180534364 CTTTGAGAGGCCAAGGAGGGTGG + Intergenic
966509810 3:180749322-180749344 CTTTAAGAGCAGAAGGAGGGTGG + Intronic
967326079 3:188241162-188241184 CTCTAGGAGCAGAAGGTGGTGGG + Intronic
967481619 3:189979716-189979738 CTTTGAGAGCCCAAGGCGGGTGG + Intronic
967842770 3:194020094-194020116 CTTTAAGAGAAGAAGGGAAGGGG - Intergenic
968251578 3:197221272-197221294 CTTTGAGAGAACAAGGCGGGTGG + Intronic
968566039 4:1313431-1313453 CTTAAAGAACAGAAGCAGGCTGG + Intronic
968840504 4:3001608-3001630 CTTTGGGAGGCGAAGGAGGGTGG - Intronic
969168302 4:5337230-5337252 CTTTAAGAGGCCAAGGTGGGTGG - Intronic
969253446 4:5986778-5986800 CTTTGAGAGGCCAAGGAGGGCGG - Intronic
969378221 4:6777252-6777274 CTTTTAGAGAAGACGGTGGGGGG - Intergenic
969663618 4:8544641-8544663 ATTTAAGAATAGAAGGAGTGAGG + Intergenic
969920534 4:10535103-10535125 CTTTGAGAGGATAAGGCGGGCGG + Intronic
970171100 4:13291215-13291237 CATTGAGAGTAGATGGAGGGAGG - Intergenic
970183420 4:13423290-13423312 CTTTAGGAGGCCAAGGAGGGTGG + Intronic
970507135 4:16743044-16743066 CTTTGGGAGCACAAGGTGGGTGG + Intronic
971507928 4:27386643-27386665 CTTTAGGAGGCCAAGGAGGGTGG - Intergenic
971512942 4:27449428-27449450 CTCGAAGAGCAGCAGGATGGAGG + Intergenic
972482949 4:39515080-39515102 CTTTAGGAGGAGGAGCAGGGAGG - Intronic
972754239 4:42028360-42028382 CTTTGAGAGGACAAGGAGGGAGG - Intronic
972760130 4:42095167-42095189 CTTTGAGAGGCCAAGGAGGGCGG + Intergenic
972925732 4:44004032-44004054 CTTTAAGAGGCCGAGGAGGGTGG + Intergenic
973772554 4:54219990-54220012 CTTTAGGAGGCCAAGGAGGGTGG - Intronic
974093502 4:57336829-57336851 TTTTCAGAGCAGCAGGAGGATGG + Intergenic
974247092 4:59333849-59333871 GTGGAAGAGCAGAAGGAAGGAGG - Intergenic
975217116 4:71768705-71768727 CTTTGGGAGGACAAGGAGGGTGG - Intronic
975323575 4:73035706-73035728 CTTTAAGGGGCCAAGGAGGGAGG - Intergenic
975429136 4:74267676-74267698 CTTTAAGAGGCCAAGGTGGGAGG - Intronic
975774229 4:77766818-77766840 CTTTGAGAGGCAAAGGAGGGTGG + Intronic
975909106 4:79247651-79247673 CATTGAGAGCAGACAGAGGGAGG + Intronic
976025749 4:80686318-80686340 CTTAGAGAGCAGAAGAAGGGAGG + Intronic
976242555 4:82973965-82973987 CTTTGGGAGGACAAGGAGGGTGG + Intronic
976415160 4:84764616-84764638 CTTTAGGAGGCGAAGGCGGGTGG + Intronic
977535438 4:98251764-98251786 CTTTGAGAGGACAAGGCGGGTGG + Intergenic
978512799 4:109539349-109539371 CTTTAAGAGGCTAAGGTGGGAGG - Intronic
979092942 4:116509954-116509976 CTTTAGGAGGACAAGGCGGGAGG - Intergenic
979640340 4:123006189-123006211 ATTAAAGAACACAAGGAGGGAGG - Intronic
979680169 4:123450623-123450645 CTTTGGGAGGATAAGGAGGGAGG - Intergenic
979827734 4:125260020-125260042 CTTTAAGAAAAGAAGGAGAATGG - Intergenic
980139142 4:128894919-128894941 CTTTAGGAGGCCAAGGAGGGTGG - Intronic
980613386 4:135186123-135186145 CTTTGAGAGCCGAAGGGAGGAGG - Intergenic
980949762 4:139363210-139363232 TTTGAAGAAGAGAAGGAGGGAGG - Intronic
981720476 4:147796766-147796788 CTTTAAGAGGCCAAGGCGGGTGG - Intronic
981950481 4:150400608-150400630 CTTTGGGAGGACAAGGAGGGAGG + Intronic
982266907 4:153546132-153546154 CTTTAAGAGGACAAGGTGGGAGG - Intronic
982980238 4:162124491-162124513 CTTTAAGAACAGAGGAAGGGAGG - Intronic
983652978 4:170052035-170052057 CTTTAAGAGGCCAAGGTGGGTGG - Intergenic
984121458 4:175750299-175750321 CTTTAAGAGGCCAAGGCGGGTGG - Intronic
984223028 4:177001370-177001392 CTGTAGGAGTAAAAGGAGGGTGG + Intergenic
984394020 4:179170970-179170992 CTTTGAGAGGCCAAGGAGGGTGG + Intergenic
984623397 4:181978350-181978372 CTTAAAGAGCAAAAGGGGGCTGG + Intergenic
984624072 4:181986259-181986281 CTTCAAGAGAAAAAGGAAGGAGG - Intergenic
985046535 4:185946642-185946664 CATTTAGAGGAGAAGCAGGGTGG - Intronic
985299728 4:188475263-188475285 CTTTGGGAGCCCAAGGAGGGTGG - Intergenic
985362786 4:189193148-189193170 CTTTGGGAGGAGAAGGAGGGTGG - Intergenic
986233806 5:5889101-5889123 CTTTAAAAGCAGAAGACAGGAGG - Intergenic
986239737 5:5950071-5950093 CTTTAGGAGGCCAAGGAGGGTGG - Intergenic
986572463 5:9179805-9179827 CTGTAAGAGCAGATGCAGTGTGG + Intronic
987323708 5:16793564-16793586 CTTTAGGAGGCCAAGGAGGGTGG - Intronic
987895471 5:23941055-23941077 CTTTAATAGGATAATGAGGGAGG - Intergenic
988419537 5:30988629-30988651 CTTTGAGAGCCCAAGGTGGGCGG + Intergenic
988587985 5:32524357-32524379 CATTAACAGCTGAAGGAAGGAGG + Intergenic
989048954 5:37299789-37299811 CTTTAAGAGGCCAAGGTGGGCGG + Intronic
989559045 5:42830019-42830041 CTTTAACAGCAGAAGGGGCTGGG - Intronic
990284807 5:54290547-54290569 CTTTGAGAGGCCAAGGAGGGCGG - Intronic
990300147 5:54441687-54441709 CTTTGGGAGGACAAGGAGGGAGG + Intergenic
990562999 5:57002444-57002466 CTTTGAGAGGCCAAGGAGGGAGG + Intergenic
991243843 5:64488820-64488842 CATTGAGAGTAGATGGAGGGAGG + Intergenic
991698032 5:69291596-69291618 CTTTGAGAGGCCAAGGAGGGTGG - Intronic
992233572 5:74685726-74685748 CTTAAGAAGCAGTAGGAGGGTGG - Intronic
992385902 5:76284545-76284567 CTCAAAGAGCAACAGGAGGGAGG + Intronic
992525552 5:77606557-77606579 CTTTGAGAGGCCAAGGAGGGAGG + Intronic
992685574 5:79196232-79196254 CTTTGAGAGGCCAAGGAGGGAGG + Intronic
992802445 5:80305822-80305844 CTTTGGGAGCCCAAGGAGGGTGG - Intergenic
992857073 5:80872560-80872582 CTTTGAGAGGCCAAGGAGGGAGG + Intronic
992900560 5:81290914-81290936 CTTTAGGAGGACAAGGTGGGTGG + Intergenic
992959538 5:81945186-81945208 CTTTGAGAGGCCAAGGAGGGCGG - Intergenic
994537077 5:101045891-101045913 CATTAAGAACAGAAGGTGGCAGG - Intergenic
994980613 5:106871542-106871564 CTTTGAGAGCCCAAGGAGGGAGG - Intergenic
995884541 5:116878863-116878885 CTTTAGGAGCCCAAGGCGGGAGG - Intergenic
996094957 5:119388885-119388907 CTTTAGGAGGATAAGGTGGGAGG - Intronic
996221188 5:120935048-120935070 CTTTGAGAGGCCAAGGAGGGCGG + Intergenic
996616703 5:125450626-125450648 ATTGAAGAGCAGAGGGAGGAAGG + Intergenic
997259458 5:132454873-132454895 CTTTAGGAGGATGAGGAGGGTGG - Intronic
997370970 5:133359740-133359762 TTTTAAAAGCTGAATGAGGGTGG - Intronic
997868711 5:137488131-137488153 CTTTAAGAGGCCAAGGTGGGCGG + Intronic
997992940 5:138561256-138561278 CTTTAGGGGCAGTAGCAGGGAGG - Intronic
998520327 5:142794361-142794383 CTATAAATACAGAAGGAGGGGGG + Intronic
998611230 5:143691401-143691423 CATTAAGAAGAAAAGGAGGGGGG - Intergenic
998621818 5:143802709-143802731 CTTTGGGAGGACAAGGAGGGTGG + Intergenic
998712455 5:144842415-144842437 CTTTGAGAGGACAAGGTGGGCGG - Intergenic
999156354 5:149460267-149460289 CTTTGAGAGGCCAAGGAGGGAGG + Intergenic
999352817 5:150892851-150892873 CTTTAAGAGGACAAGGTGGGAGG - Intronic
999822073 5:155238396-155238418 CATTCAAAGCAGAAGTAGGGAGG - Intergenic
999939056 5:156520772-156520794 CTTTGGGAGGACAAGGAGGGTGG + Intronic
1000009958 5:157221753-157221775 CTCTAAGAGCTTATGGAGGGAGG - Intronic
1000335802 5:160240476-160240498 GTTTCAGAGCAGAATGTGGGAGG - Intergenic
1001041550 5:168339268-168339290 CTCTAAGAGCAGAGGGATGAGGG + Intronic
1001132561 5:169076603-169076625 CTTTAAGAGGAGAGAGAGGGTGG + Intronic
1001553918 5:172623528-172623550 CTTAAAGAGCAGAAGAACGCTGG + Intergenic
1002031922 5:176436107-176436129 CTTTGAGAGGACAAGGAGGGTGG - Intergenic
1002085245 5:176770773-176770795 CTTTAGGAGGCCAAGGAGGGTGG + Intergenic
1002545225 5:179938199-179938221 CTTTGAGAGGCCAAGGAGGGTGG - Intronic
1003329414 6:5117311-5117333 CTTTAAGAGCCCGAGGTGGGTGG + Intronic
1004082990 6:12414311-12414333 CTTTGAGAGGACAAGGAGAGGGG + Intergenic
1004465847 6:15884024-15884046 CTTTGAGAGGCCAAGGAGGGAGG + Intergenic
1005695560 6:28349829-28349851 CTTTAATAGCAAAAGGGGAGGGG + Intronic
1006036871 6:31220828-31220850 CTTTCAGAGGCCAAGGAGGGCGG - Intergenic
1006123063 6:31819145-31819167 CTTTTAGTGCAGGAGGTGGGTGG - Intergenic
1006193318 6:32222573-32222595 CTTTTGGAACAGAAGGAGGGAGG + Exonic
1006263058 6:32893466-32893488 CTTTAAGAGGTGGAGGCGGGAGG + Intergenic
1006677558 6:35775402-35775424 CTTCAAAAGCAGAAGCAGGCTGG + Intergenic
1006730654 6:36233741-36233763 CCTGAAGAGCAGAAGCAGAGGGG + Intergenic
1006733746 6:36256687-36256709 CTTTAAGAGCCTGAGGCGGGTGG - Intronic
1007062556 6:38955215-38955237 CTTTAGGAGGCCAAGGAGGGAGG - Intronic
1007077183 6:39075280-39075302 CTGCTAGAGCAGGAGGAGGGAGG + Intronic
1007669573 6:43540144-43540166 CTTTGAGAGGCCAAGGAGGGGGG + Intronic
1008588322 6:52969081-52969103 CTTTAGGAGGCCAAGGAGGGTGG + Intergenic
1008669412 6:53751934-53751956 CTTTATTAGCAGAAGGGAGGAGG + Intergenic
1009633520 6:66232619-66232641 CTTTAAGAGAGGAAGCAGAGAGG + Intergenic
1010134828 6:72539148-72539170 CTTTAAGAGGTCAAGGTGGGTGG - Intergenic
1011221243 6:85056710-85056732 CTTTAAAGGCAAAAGGAGAGAGG + Intergenic
1011300004 6:85863920-85863942 CTTTAACAGCAGTGGGAGTGGGG + Intergenic
1012026652 6:94002795-94002817 CTTCAACAGCAGAAGCACGGAGG - Intergenic
1012401057 6:98843308-98843330 CTTTAAGAGCTGAAGCACGGGGG + Intergenic
1013512256 6:110855835-110855857 CTTTGAGAGGCCAAGGAGGGTGG + Intronic
1014484121 6:121978091-121978113 CTTTAAGAGAATAGGGAGGGAGG + Intergenic
1014697225 6:124638650-124638672 CTTTGAGAGCCCAAGGTGGGTGG + Intronic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1016330145 6:142946102-142946124 CCTTAAGGACAGAGGGAGGGCGG + Intergenic
1017440044 6:154456452-154456474 CTTTGAGAGGCCAAGGAGGGTGG + Intronic
1017963968 6:159247503-159247525 CTTTGAGAGGTCAAGGAGGGAGG + Intronic
1018115168 6:160576232-160576254 CTTGAAGAGCAAAAGCAGGAAGG - Intronic
1018487576 6:164257473-164257495 CTTTGAGAGGCCAAGGAGGGTGG + Intergenic
1018900258 6:168048364-168048386 CTTCAAGGTCAGAAGGAGGACGG - Intergenic
1019375564 7:689993-690015 TTTAAAGAGCTGAGGGAGGGAGG + Intronic
1019583498 7:1782068-1782090 CTTTGGGAGGACAAGGAGGGCGG + Intergenic
1020814599 7:12889702-12889724 CTTTGAGAGGCCAAGGAGGGTGG + Intergenic
1021111135 7:16696033-16696055 CTTCAAAAGCAGAAGGAGCCGGG - Intronic
1022082472 7:27036447-27036469 CTTTGAGAGGGCAAGGAGGGCGG + Intergenic
1022710325 7:32843030-32843052 AGCAAAGAGCAGAAGGAGGGGGG + Intergenic
1023180217 7:37474906-37474928 CTTTAGGAGGCCAAGGAGGGAGG - Intergenic
1024241296 7:47438579-47438601 CTTCAAGACCAGAAAGAGGCAGG + Intronic
1024627855 7:51223648-51223670 CTTTGAGAGCAGAACAAGTGAGG - Intronic
1025069267 7:55884677-55884699 CTTTAAGAGCCCAAGGCAGGAGG + Intergenic
1025091246 7:56065837-56065859 CTTTAAGAGCCTGAGGCGGGCGG + Intronic
1026186433 7:68085298-68085320 CTTTAGGAGGCCAAGGAGGGAGG - Intergenic
1026303384 7:69118926-69118948 CTTTAAGAGGACAAGGTGGGTGG - Intergenic
1026337968 7:69411098-69411120 CTTTGGGAGCACCAGGAGGGTGG - Intergenic
1026503259 7:70960580-70960602 CTGCCAGAGGAGAAGGAGGGTGG + Intergenic
1026519599 7:71105104-71105126 CTTTGAGAGGCCAAGGAGGGTGG - Intergenic
1026556913 7:71416366-71416388 CTTTAGGAGCCCAAGGTGGGTGG + Intronic
1026801531 7:73403229-73403251 CTTTGAGAGGCCAAGGAGGGAGG + Intergenic
1026961762 7:74412828-74412850 CTTTGAGAGGACAAGGTGGGAGG + Intergenic
1027161965 7:75809339-75809361 CTTTAAGAGGCCAAGGTGGGAGG - Intergenic
1027776368 7:82470379-82470401 CTTTGAGAGGTGAAGGCGGGTGG - Intergenic
1027806550 7:82832494-82832516 CTTTGGGAGCCCAAGGAGGGTGG - Intronic
1028347387 7:89799048-89799070 CATTGAGAGTAGATGGAGGGAGG - Intergenic
1028608266 7:92679960-92679982 CTTTAGGAGGCCAAGGAGGGCGG - Intronic
1029093194 7:98064611-98064633 CTTTGAGAGGCCAAGGAGGGTGG + Intergenic
1029383526 7:100228623-100228645 CTTTAGGAGGCGAAGGTGGGAGG + Intronic
1029464095 7:100714730-100714752 CTTTAGGAGGCTAAGGAGGGAGG - Intergenic
1029473353 7:100768226-100768248 CTTTGAGAGCCCGAGGAGGGTGG + Intronic
1029480636 7:100810496-100810518 CTTTGAGAGGTTAAGGAGGGAGG + Intronic
1029641918 7:101826443-101826465 CTTTAGGAGACCAAGGAGGGAGG - Intronic
1029924233 7:104298640-104298662 CTTTAAGAGGCCAAGGTGGGTGG - Intergenic
1031342006 7:120614254-120614276 CTTTGAGAGGCCAAGGAGGGCGG - Intronic
1031497666 7:122470737-122470759 CTTTGAGAGGCCAAGGAGGGTGG - Intronic
1032041589 7:128567463-128567485 CTTTGAGAGCATGAGGTGGGAGG - Intergenic
1032642362 7:133783983-133784005 CTTTAAGAGCAGAAGGATGGGGG - Intronic
1033024035 7:137755402-137755424 GTTTAAGGGCAGAGGGAGGAGGG + Intronic
1033060393 7:138100945-138100967 CTTTGAGAGGCGGAGGAGGGTGG - Intronic
1033081272 7:138300265-138300287 CTTTGAGAGGCCAAGGAGGGCGG - Intergenic
1033618761 7:143042715-143042737 AATTGTGAGCAGAAGGAGGGAGG - Intergenic
1033915380 7:146317896-146317918 CTTTGGGAGGCGAAGGAGGGCGG + Intronic
1033970275 7:147030773-147030795 CTTTAAGAGGCCAAGGTGGGAGG + Intronic
1034110185 7:148529383-148529405 CTTTAAGAGGCCAAGGCGGGTGG + Intergenic
1034573682 7:151979408-151979430 TTTTAAGAGTAAAAGGAGGCCGG - Intronic
1035110346 7:156476348-156476370 CTTTTGGAGGAGAAGGAAGGTGG - Intergenic
1035351525 7:158250464-158250486 GGTTAAGAGCAGATGGAGAGGGG - Intronic
1035574999 8:698719-698741 CTTTAGGAGGCCAAGGAGGGAGG - Intronic
1036581123 8:10076848-10076870 ATTTAAGAGCAGAGGATGGGGGG + Intronic
1036799712 8:11781266-11781288 CTGGAAGTTCAGAAGGAGGGTGG + Intronic
1036911383 8:12760102-12760124 CTTTAAGAGGCCAAGGTGGGTGG + Intergenic
1037022378 8:13989357-13989379 CTTTGAGAGCCCTAGGAGGGTGG - Intergenic
1037554180 8:20006004-20006026 CTTTAAGAGGCCAAGGTGGGAGG + Intergenic
1038533112 8:28334735-28334757 CTTTAGGAGGCCAAGGAGGGAGG - Intronic
1038657692 8:29469119-29469141 CTTTAAGGGCTGAAGCAGGAAGG + Intergenic
1038755910 8:30340492-30340514 CTTTGAGAGGACAAGGAGGGAGG - Intergenic
1039053523 8:33515456-33515478 CTTTAGGAGGCCAAGGAGGGAGG - Intergenic
1039165021 8:34669122-34669144 CTTTGGGAGCCCAAGGAGGGTGG + Intergenic
1039502197 8:38027065-38027087 CTTTAAGAGGCTGAGGAGGGAGG + Intergenic
1040023171 8:42758605-42758627 CTTTGAGAGCCCAAGGTGGGCGG - Intronic
1040592233 8:48804329-48804351 CCTTCAGAGGAGAGGGAGGGTGG + Intergenic
1040873023 8:52120494-52120516 TTTCAAGATCAGAAGGAGGCAGG + Intronic
1040910602 8:52514695-52514717 CTTTGGGAGGACAAGGAGGGTGG + Intergenic
1041062037 8:54043802-54043824 CTTTGAGAGGCCAAGGAGGGTGG - Intergenic
1041066438 8:54086617-54086639 CTTTAAGAGCCCAAAGTGGGGGG + Intronic
1041171340 8:55145073-55145095 CTTTGAGAGCCCAAGGCGGGCGG - Intronic
1041746916 8:61217356-61217378 CTTTAAGGGGAGAAGGAGGAGGG + Intronic
1042906395 8:73776582-73776604 CTTTAAGAGCCTGAGGTGGGTGG + Intronic
1043075016 8:75687502-75687524 CTTTGAGAGGCCAAGGAGGGTGG - Intergenic
1043564661 8:81534697-81534719 CTTTGAGAGCCCAAGGTGGGAGG + Intergenic
1044668041 8:94650946-94650968 CTTTAAGAGGCCAAGGCGGGCGG - Intronic
1044708673 8:95033815-95033837 CTTAAAGAACAGAAGAAGGCAGG + Intronic
1044743748 8:95352748-95352770 CTTTATGAGAAGAAAGGGGGAGG - Intergenic
1044870017 8:96609960-96609982 TTTTAAGGGCACAAGAAGGGAGG - Exonic
1045160236 8:99533180-99533202 CTTTAAGAGGCCAAGGTGGGCGG - Intronic
1045308173 8:100977094-100977116 CTTTAAGAGGGAAAGGTGGGTGG + Intergenic
1045947354 8:107811513-107811535 CTTTGGGAGGACAAGGAGGGTGG + Intergenic
1045976569 8:108136425-108136447 CTTTAGGAGCAAAAAGAGGGAGG + Intergenic
1046541419 8:115588510-115588532 CTTTAACAGCAGAAGATGGTAGG - Intronic
1046571891 8:115976509-115976531 CTTTAATTGCAGGAGGAGGGTGG + Intergenic
1047066373 8:121288498-121288520 CTTTAGGAGGCCAAGGAGGGTGG + Intergenic
1047282230 8:123455666-123455688 CTTTAGGAGGCCAAGGAGGGTGG - Intronic
1048353182 8:133632425-133632447 CTTTAAGAGGCCAAGGCGGGTGG + Intergenic
1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG + Intergenic
1050042055 9:1506363-1506385 TTTTAAAAGGAGAGGGAGGGAGG - Intergenic
1050224380 9:3434686-3434708 TTTGGAGTGCAGAAGGAGGGTGG - Intronic
1050334808 9:4580335-4580357 CTTTAAGAGGCCAAGGCGGGCGG + Intronic
1050358109 9:4802166-4802188 CTTTGAGAGCCCAAGGCGGGTGG - Intronic
1051457293 9:17272890-17272912 AAATAAGGGCAGAAGGAGGGAGG - Intronic
1051508347 9:17849312-17849334 ATTTAAGGGCAGAATCAGGGAGG + Intergenic
1051544375 9:18257944-18257966 TCTTCAGAGCAGAAGGAAGGAGG + Intergenic
1052048008 9:23817353-23817375 CTTTATGAAGAGAAGGATGGGGG - Intronic
1052308853 9:27042008-27042030 CTTTTAGGAGAGAAGGAGGGAGG + Intronic
1052782953 9:32799469-32799491 CTTTAAGAGGCTAAGGTGGGTGG - Intergenic
1052930347 9:34050617-34050639 CTTTGGGAGCCGGAGGAGGGCGG + Intergenic
1053057313 9:35001178-35001200 CTTTAAGAGCCGAAGAAGACAGG - Intergenic
1053114016 9:35486373-35486395 CTTTAAGAGGTGGAGGCGGGTGG + Intergenic
1053162140 9:35820494-35820516 CCTGAAGAGGAGAAGGAGGTTGG + Intronic
1053368122 9:37538152-37538174 CTTTGAGATTAGAAGGATGGAGG - Intronic
1053440966 9:38116234-38116256 GTTTAGGAGCACAAGGTGGGAGG - Intergenic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1055223997 9:73971311-73971333 CTTTGGGAGGACAAGGAGGGTGG - Intergenic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1055895582 9:81171021-81171043 CTTTAAAACCAGAAAGAGTGGGG - Intergenic
1056066647 9:82942402-82942424 TTTTAAGAGGAGAAAGAGGATGG + Intergenic
1056642472 9:88383212-88383234 CTTTGGGAGGCGAAGGAGGGCGG - Intergenic
1056954399 9:91070903-91070925 CTTTGAGAGGCCAAGGAGGGAGG + Intergenic
1057176882 9:93006968-93006990 CTTTGAGAGGCCAAGGAGGGCGG - Intronic
1057350298 9:94291293-94291315 CTTTGAGAGGACAAGGCGGGTGG - Intronic
1057529308 9:95830307-95830329 CTTTAAGAGGCCGAGGAGGGAGG + Intergenic
1057778655 9:98031940-98031962 CTTTAGGAGGCCAAGGAGGGAGG + Intergenic
1057811761 9:98262796-98262818 CTTTAAGAGGCGGAGGTGGGCGG + Intergenic
1057883937 9:98814463-98814485 CTTTAGGAGGCCAAGGAGGGCGG + Intronic
1058378008 9:104347172-104347194 CTTTGAGAGGACAAGGAGGGCGG + Intergenic
1058381359 9:104380352-104380374 ATTTAATAGCTGAGGGAGGGTGG - Intergenic
1058472067 9:105290057-105290079 CTTTAGGAGGCCAAGGAGGGTGG - Intronic
1058836400 9:108861930-108861952 CGTTAAGAGCAAAAGCAGGGTGG - Intergenic
1058899970 9:109433660-109433682 CTTTACGAGGCCAAGGAGGGTGG + Intronic
1059099138 9:111452998-111453020 CTTTGAGAGACCAAGGAGGGAGG + Intronic
1059420756 9:114190509-114190531 CTTTAAGAGGCCAAGGAAGGAGG - Intronic
1059633785 9:116153697-116153719 CATTTTGAGAAGAAGGAGGGAGG + Intergenic
1061248036 9:129411465-129411487 CTTTAGGAGGATGAGGAGGGCGG - Intergenic
1061286016 9:129623088-129623110 CTTTGAGAGGACAAGGCGGGTGG + Intronic
1062420404 9:136478159-136478181 CTTTAAGAGGCCAAGGCGGGAGG + Intronic
1186088163 X:6013937-6013959 CTTTAAGAGGCCAAGGAGAGCGG + Intronic
1186796620 X:13052743-13052765 CTTTCAGAGCAGAATGTCGGGGG + Intergenic
1187159465 X:16751008-16751030 CTTTAGGAGGCTAAGGAGGGCGG - Intronic
1187177526 X:16909976-16909998 CTTTGAGAGGCCAAGGAGGGAGG - Intergenic
1187883292 X:23865650-23865672 CTTTGAGGGCAGCAGCAGGGTGG - Intronic
1188488987 X:30716272-30716294 CTTTGAGAGTATAAGGAGGAGGG + Intronic
1189390530 X:40572654-40572676 CTTTAGGAGGCCAAGGAGGGTGG + Intergenic
1190183159 X:48211211-48211233 CTGTAAGTGGAGAAGGAGGGAGG + Intronic
1190194507 X:48305531-48305553 CTTTGGGAGGACAAGGAGGGCGG + Intergenic
1190257174 X:48772290-48772312 CTTTAGGAGGCCAAGGAGGGAGG + Intronic
1190815737 X:53927590-53927612 CTTTAGGAGGCCAAGGAGGGTGG + Intergenic
1190856831 X:54304284-54304306 CTTTAAGAGGCCAAGGTGGGTGG + Intronic
1190922543 X:54869439-54869461 CTTTGGGAGGTGAAGGAGGGAGG - Intergenic
1191732638 X:64353702-64353724 CTTTGAGAGGCCAAGGAGGGAGG + Intronic
1192057887 X:67791648-67791670 CTTTGGGAGGACAAGGAGGGAGG + Intergenic
1192194745 X:69020793-69020815 CTTTAAGAGCAAACGGTGGGAGG + Intergenic
1192298853 X:69879695-69879717 CTTTAAGAGGAAAAGGAAGATGG + Intronic
1192824152 X:74677489-74677511 CTTTAAGAGGCCAAGGTGGGTGG + Intergenic
1193099041 X:77586813-77586835 CTTTAAGAGGCCAAGGCGGGTGG + Intronic
1193101433 X:77617991-77618013 CTTTAAGAGGCCAAGGTGGGAGG - Intronic
1193658163 X:84223921-84223943 CTTTGGGAGCCCAAGGAGGGAGG + Intergenic
1194487634 X:94505297-94505319 CTCTAAGAGCAGAGGCAGTGAGG + Intergenic
1195144405 X:101999282-101999304 CATTGAGAGTAGATGGAGGGAGG + Intergenic
1196267485 X:113667429-113667451 CATTATTAGCAAAAGGAGGGTGG + Intergenic
1196487986 X:116236087-116236109 CTAAAAGAGCACAAGGATGGAGG - Intergenic
1196664550 X:118302994-118303016 CTTTGGGAGCCCAAGGAGGGAGG + Intergenic
1196676536 X:118426456-118426478 CTTTAAGAGGCCAAGGTGGGAGG + Intronic
1196873797 X:120138335-120138357 CTTTAAGAGGCCAAGGTGGGTGG + Intergenic
1197148791 X:123197045-123197067 TTGTAAGAGCAATAGGAGGGTGG + Intronic
1197231025 X:124003665-124003687 CTTTGAGAGGCCAAGGAGGGTGG - Intronic
1197787544 X:130214041-130214063 CTTTAAGAGGCCAAGGAGGGAGG - Intronic
1198009455 X:132536064-132536086 TTTTAAAAGCAGAAGTAGGCCGG + Intergenic
1198049186 X:132931941-132931963 CTTTGGGAGCCGAAGGTGGGCGG + Intronic
1198091063 X:133330702-133330724 CTTTAGGAGCCCAAGGCGGGAGG + Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199604237 X:149563825-149563847 CTATAATAGCAGGTGGAGGGGGG + Intergenic
1200209258 X:154339138-154339160 CTTTGAGAGGCCAAGGAGGGAGG + Intergenic
1200216715 X:154371380-154371402 CTTTAAATGCGGGAGGAGGGCGG + Intronic
1200221618 X:154392991-154393013 CTTTGAGAGGCCAAGGAGGGAGG - Intronic
1201504857 Y:14687037-14687059 CTTTGAGAGGTCAAGGAGGGAGG - Intronic
1201690070 Y:16753324-16753346 CCCAAAGAGCAGAAGCAGGGTGG - Intergenic
1201982896 Y:19926713-19926735 CTTTAGGAGCCCAAGGTGGGTGG + Intergenic