ID: 966513378

View in Genome Browser
Species Human (GRCh38)
Location 3:180789334-180789356
Sequence TACCCAAAGCTACTTCATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966513378_966513382 29 Left 966513378 3:180789334-180789356 CCAGTATGAAGTAGCTTTGGGTA 0: 1
1: 0
2: 0
3: 6
4: 82
Right 966513382 3:180789386-180789408 GACAATATCAAACGTTGGCAAGG 0: 1
1: 4
2: 60
3: 380
4: 1626
966513378_966513381 24 Left 966513378 3:180789334-180789356 CCAGTATGAAGTAGCTTTGGGTA 0: 1
1: 0
2: 0
3: 6
4: 82
Right 966513381 3:180789381-180789403 CTTCTGACAATATCAAACGTTGG 0: 1
1: 0
2: 1
3: 14
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966513378 Original CRISPR TACCCAAAGCTACTTCATAC TGG (reversed) Intronic
908090180 1:60677623-60677645 GACCCAAAACTACCCCATACTGG + Intergenic
912785307 1:112597124-112597146 TAACTAAAGTTACTTCATAGAGG + Intronic
921129181 1:212205081-212205103 TAACAATAGCTACTTCATAAAGG + Intergenic
1071076812 10:81764571-81764593 TACCCAAAGCAGCATGATACTGG - Intergenic
1074237096 10:111596309-111596331 TTCCCAAAATTACATCATACGGG + Intergenic
1077902701 11:6502580-6502602 TACTCAAAGATACCACATACTGG - Intronic
1082144036 11:48645587-48645609 TAACCAAAGCAACATGATACTGG - Intergenic
1087051654 11:93891784-93891806 TAACAAAAGCTACTTCAGGCTGG + Intergenic
1087074816 11:94119348-94119370 TGCCCAAAGCTCCATCATAGCGG + Intergenic
1088421583 11:109654521-109654543 TCCCAAAAGCTTATTCATACTGG - Intergenic
1088562345 11:111127951-111127973 TACCAAATGCTACTCCACACTGG + Intergenic
1088643177 11:111893729-111893751 TAACCAAAGCAACATGATACTGG + Intergenic
1093440648 12:19191913-19191935 CACCCAAAGCTAAGTCATAATGG - Intronic
1093580759 12:20782211-20782233 TGCCCAAAGCCCCGTCATACCGG - Intergenic
1097951250 12:65430870-65430892 TACAGAATGCCACTTCATACAGG + Intronic
1099593673 12:84628882-84628904 TAGCCAAAGATAATTCATAATGG + Intergenic
1107200586 13:37712269-37712291 TACCCAATGCTACATAGTACAGG + Intronic
1110486919 13:76056730-76056752 GACCCACAGCTATATCATACTGG + Intergenic
1111766226 13:92533502-92533524 TATCCAAAGCTATATTATACGGG - Intronic
1116121218 14:40723964-40723986 TACCCCAAGCTGTTTCATCCCGG + Intergenic
1116482675 14:45410585-45410607 TAACCAAAACAACATCATACTGG - Intergenic
1121882380 14:97512478-97512500 TTCTAAAAGCTACTTCATATTGG + Intergenic
1125661282 15:41396849-41396871 TATCCAAAGCAACTTCTTTCTGG + Exonic
1127833765 15:62773356-62773378 TACTGAAAACTACTTCACACTGG - Intronic
1143652534 17:8272500-8272522 TTCCCAAAGCTACTTCAGTATGG - Intergenic
1153983398 18:10331918-10331940 TACCCAAATCTCCATCACACTGG - Intergenic
1155867257 18:30981270-30981292 TACACAAATGTACTTCATGCAGG - Intergenic
1164015316 19:21251360-21251382 TAACCAAAGCGACATTATACTGG + Intronic
1164175988 19:22775178-22775200 TAACCAAAGCCACATAATACTGG + Intronic
1168438571 19:56343209-56343231 TATCCAAAGCAACTTCTTTCTGG + Intronic
929280635 2:40074181-40074203 TAACCAAAGCTGCATGATACTGG - Intergenic
930839595 2:55830824-55830846 TAACCAAAGCTGCATGATACTGG + Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
934501667 2:94865246-94865268 TGCCCAAAGCTACAACATTCAGG + Intergenic
935304236 2:101721384-101721406 TACTCAAAGATATTTCAGACAGG - Intronic
935470520 2:103454267-103454289 TGCACAAAGTTACTTCAAACTGG + Intergenic
940140895 2:150489248-150489270 TTCCCAAAACTACTTAACACAGG + Intronic
941253382 2:163196154-163196176 TAGCCAAAGATATTTCATAGCGG + Intergenic
943613390 2:190062333-190062355 TACCCAAAGCTCCTCCACTCCGG - Exonic
947280895 2:228453448-228453470 TGCCCAAAGCAAATTCATACAGG - Intergenic
1184279833 22:43430619-43430641 TCCCCAAAGCTTCTGCCTACTGG - Intronic
949974256 3:9440533-9440555 TAGTGAAAGCTTCTTCATACTGG - Exonic
951260174 3:20498138-20498160 TACCCTAAGAGAATTCATACAGG - Intergenic
951595079 3:24310004-24310026 TCCCCAAAGCTACTGAGTACGGG + Intronic
965425813 3:168521188-168521210 TATCCTAAGCTAATTAATACAGG - Intergenic
965633359 3:170755969-170755991 TACTCCAAGATACTTCTTACTGG - Intronic
966513378 3:180789334-180789356 TACCCAAAGCTACTTCATACTGG - Intronic
967391932 3:188964850-188964872 AACGCAAAGCTAATTCATCCTGG + Intronic
970301284 4:14683933-14683955 TTCCTAAAGCTACTGGATACTGG + Intergenic
971144220 4:23959550-23959572 TCCCCAAAGCCACGTCATGCTGG - Intergenic
973239186 4:47939177-47939199 TACCCCAACCTCCTTCATCCAGG + Intronic
974250199 4:59375649-59375671 TACCCCAAGCTATTTCACCCTGG + Intergenic
975005065 4:69273664-69273686 CACCCAAAGCTAATTTATAAAGG - Intergenic
975013488 4:69382643-69382665 CACCCAAAGCTAATTTATAAAGG - Intronic
979011043 4:115368845-115368867 TTCCCAAGGCTGCTTTATACTGG + Intergenic
980094275 4:128473448-128473470 TATCCAAAGCTGCTGCCTACTGG + Intergenic
981282075 4:142969999-142970021 TACCTTAATCTACTTCATACAGG + Intergenic
987216372 5:15742112-15742134 TATCCAAAACTACTTAATAAGGG + Intronic
987929659 5:24388194-24388216 TGCCCAAAGCCCCATCATACAGG + Intergenic
988359826 5:30221713-30221735 TAATCAAAGCTACCTCATAAGGG - Intergenic
992429428 5:76693605-76693627 TTCCCATTGATACTTCATACAGG - Intronic
993689807 5:90986145-90986167 TCCTCAAAGCTACAACATACCGG - Intronic
994179478 5:96748383-96748405 CACCCAAAGCTAATTTATAAAGG - Intronic
999197578 5:149793023-149793045 TACCCTCAGCTGCTTCATCCAGG + Intronic
1009470545 6:64025628-64025650 TGCCCAAAGCTCCGTCATAGTGG + Intronic
1013320164 6:108980407-108980429 AACCAACAGATACTTCATACGGG - Intergenic
1016285869 6:142472359-142472381 TACCATAAGCTATTTCTTACTGG - Intergenic
1016833189 6:148453023-148453045 TACCCCAAGCTCCTGCATTCTGG - Intronic
1023296787 7:38723346-38723368 TAGCCAAAGGGATTTCATACTGG - Exonic
1023711312 7:42996129-42996151 ACCCCAAAGCCACCTCATACAGG + Intergenic
1024264999 7:47599682-47599704 TACCCCAAGCTGTTTCATCCTGG - Intergenic
1024578202 7:50781922-50781944 TACTCAAAGCTTTTTTATACCGG + Intronic
1031546938 7:123062580-123062602 TACCCAAACCTACTTGATCTTGG - Intergenic
1034300314 7:150009513-150009535 TACCCAAAGCTACTGCATTTGGG - Intergenic
1034805741 7:154087795-154087817 TATCCAAAGCTACTGCATTTGGG + Intronic
1041475033 8:58255127-58255149 TACCCAATTCTCCTTCAAACTGG + Intergenic
1045011045 8:97958607-97958629 AACCCAAAGCTACTTCAGCCCGG + Intronic
1048458413 8:134599453-134599475 TACAGAAGGCTATTTCATACAGG + Intronic
1055060451 9:72063258-72063280 TACCAAAACCTATTTCCTACAGG - Intronic
1057301760 9:93890236-93890258 TACCCAAAGAAACTGCAAACAGG + Intergenic
1058881841 9:109292240-109292262 TACCTGAAGCTACTTGATTCTGG + Intronic
1059752827 9:117264727-117264749 TATCCAAACTTACTTAATACTGG + Intronic
1059924761 9:119197603-119197625 TTCCCAAAGTTACTTCATGGAGG - Intronic
1189457509 X:41206663-41206685 TAGGCAACGCTACTTCATAGGGG + Intronic
1195888345 X:109665885-109665907 TAACAAAACCTACTTCATACAGG + Intronic
1198852923 X:140984917-140984939 TTTCCAAAGCCACTTGATACTGG + Intergenic
1199271635 X:145890016-145890038 TAACCAAAACAACATCATACCGG - Intergenic
1199545722 X:149005706-149005728 TAGCCAAAGCTGCTTCATCCGGG + Intergenic
1201468597 Y:14311316-14311338 TGCCCAAAGTTCCATCATACTGG + Intergenic