ID: 966516159

View in Genome Browser
Species Human (GRCh38)
Location 3:180822903-180822925
Sequence CCTTGAAGGCAGAGGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1675
Summary {0: 1, 1: 5, 2: 39, 3: 265, 4: 1365}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966516148_966516159 27 Left 966516148 3:180822853-180822875 CCACTGAATACATATGGACACAA 0: 1
1: 1
2: 5
3: 18
4: 177
Right 966516159 3:180822903-180822925 CCTTGAAGGCAGAGGGTGGGAGG 0: 1
1: 5
2: 39
3: 265
4: 1365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966516159 Original CRISPR CCTTGAAGGCAGAGGGTGGG AGG Intronic
900096945 1:943676-943698 CCTGGAAGGGGGAGGGAGGGAGG - Exonic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900492080 1:2955387-2955409 CCATGAAAGCAGCTGGTGGGGGG - Intergenic
900508661 1:3044891-3044913 ACTTGAAGGTAGAGAGTGGAAGG - Intergenic
900672823 1:3866329-3866351 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
901218957 1:7571482-7571504 ACCTGAAGGCAGAAGGTGGGAGG - Intronic
902036701 1:13463168-13463190 TCCTGAAGGCAGAGGGAGGGAGG + Intergenic
902085170 1:13854578-13854600 ACTTGAAGGGGAAGGGTGGGAGG - Intergenic
902087060 1:13871416-13871438 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
902175064 1:14643316-14643338 ACTTGAAGGTGGAGGGTGGGAGG - Intronic
902241635 1:15094087-15094109 CCCGGGAGGCAGAGGGTGGTGGG - Intronic
902367841 1:15989229-15989251 CCTTGAGGGCACAGGGAGGTGGG - Intergenic
902810146 1:18883428-18883450 CCTGCAAGGCAGAGGGCCGGGGG + Exonic
902975322 1:20084257-20084279 CTTTGCAGGCAGAGGCTGGGCGG - Intronic
903012792 1:20343086-20343108 TCTCGAAGGCAGAGGGATGGTGG - Exonic
903122822 1:21227389-21227411 CCCTGAAGCCAGAGGGAGGCTGG + Intronic
903372171 1:22843491-22843513 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
903404883 1:23088010-23088032 CCTAGAAGGCAGAGGATGCTGGG + Exonic
903660012 1:24971317-24971339 CCTTGGAGGAAGTGAGTGGGAGG - Intergenic
903847028 1:26284749-26284771 CCGTGAAGGCAGAGTGTGAGGGG + Intronic
903904312 1:26672985-26673007 CTTTGAAGGGAGAAGGTGGGAGG - Intergenic
904232997 1:29092697-29092719 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
904483734 1:30810331-30810353 CTTCTAAGGCAGAGGATGGGGGG - Intergenic
905267490 1:36764872-36764894 CCTTGGCTGAAGAGGGTGGGTGG - Intergenic
905352312 1:37356309-37356331 CCTTGAGGGCAGGGCGGGGGTGG - Intergenic
905532093 1:38687926-38687948 ACCTGAAGGCGGAGGGTAGGAGG - Intergenic
905790718 1:40787861-40787883 CCTTGAAGTCAGAGTGCTGGAGG + Intronic
906061745 1:42953488-42953510 CCATGATGGCGGAGGCTGGGAGG - Intronic
906887920 1:49672336-49672358 ACTTGAGGGGGGAGGGTGGGAGG + Intronic
906888857 1:49685054-49685076 TCTTGAAGGTGGAAGGTGGGAGG - Intronic
907309421 1:53530760-53530782 CTTTGAAGGCTGAGGGAGGTTGG - Intronic
908017174 1:59855283-59855305 ACTTGAGAGCAGAGGGTTGGTGG - Intronic
908083068 1:60601027-60601049 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
908113535 1:60919918-60919940 CCATGAATGCAATGGGTGGGAGG + Intronic
908229235 1:62087362-62087384 CTTTGTAGGCATAGGATGGGGGG + Intronic
908304653 1:62799952-62799974 CCATGGAGGCAGAGAGTGGAAGG - Intronic
908353876 1:63312880-63312902 CCTTGAAGGTAGAGACTGAGAGG - Intergenic
908697262 1:66857608-66857630 CCTGGGAGGCAGAGGTTGTGGGG - Intronic
908926794 1:69265484-69265506 ACCTGAGGGCAGAGGATGGGAGG - Intergenic
908981328 1:69962819-69962841 ACTGGAGGACAGAGGGTGGGAGG + Intronic
909101433 1:71354106-71354128 TCTTGACGGCAGAGGGTGGGAGG + Intergenic
909102005 1:71359443-71359465 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
909149186 1:71979202-71979224 ACTTGAAGGTAAAGGGTGGGAGG + Intronic
909373273 1:74912545-74912567 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
909473808 1:76059516-76059538 CAGTGAAAGCAGCGGGTGGGAGG + Intergenic
909695704 1:78465796-78465818 GCTTGAAGGCAGAAGGTGTGGGG + Intronic
909994320 1:82260421-82260443 ACTTGGAGGGGGAGGGTGGGAGG + Intergenic
910139755 1:84014067-84014089 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
910166349 1:84331882-84331904 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
910592239 1:88938530-88938552 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
910731625 1:90403963-90403985 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
910736297 1:90461596-90461618 ACTTGAGGGCAGAGGGAGGGAGG - Intergenic
911340370 1:96628660-96628682 CTTTGAAGGTAGAGGGTGGGAGG + Intergenic
911543931 1:99192710-99192732 ACTTGAGGGTAGAGGGTGGAAGG + Intergenic
911990216 1:104686657-104686679 ACTTGAGGGCAGAGAGTGGGAGG - Intergenic
912008686 1:104933516-104933538 CCGTGCTGGCAGAGGGCGGGAGG - Intergenic
912216260 1:107616431-107616453 CCTTGAGGGTGGAAGGTGGGAGG + Intronic
912326079 1:108764031-108764053 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
912474210 1:109925353-109925375 CCTGGAAAGGAGAGGGTGGCTGG - Intronic
912890976 1:113530442-113530464 ATTTGAGGGTAGAGGGTGGGAGG + Intronic
912891200 1:113533429-113533451 CCTTCAGGGTGGAGGGTGGGAGG + Intronic
913030110 1:114892918-114892940 CTTAGAACTCAGAGGGTGGGTGG + Intronic
913573745 1:120148058-120148080 ACTTAACGGTAGAGGGTGGGAGG - Intergenic
914049299 1:144118481-144118503 CTTTGAGGGTGGAGGGTGGGAGG + Intergenic
914129885 1:144846963-144846985 CTTTGAGGGTGGAGGGTGGGAGG - Intergenic
914295007 1:146312860-146312882 ACTTAACGGTAGAGGGTGGGAGG - Intergenic
914556048 1:148763643-148763665 ACTTAACGGTAGAGGGTGGGAGG - Intergenic
914696182 1:150082428-150082450 CCTGGGAGGCGGAGGTTGGGAGG + Intronic
914994233 1:152527420-152527442 ACTTGAGGGCCGAGGGTGGGAGG - Intronic
915305646 1:154975921-154975943 GCTTGAGGGAGGAGGGTGGGAGG + Intronic
915369424 1:155335895-155335917 CATTGCAGGGAGTGGGTGGGAGG - Intronic
915444502 1:155967046-155967068 GCTTGAAGGAAGAGGGAGGTGGG - Intronic
915547516 1:156609755-156609777 ACTTGAGGGAGGAGGGTGGGAGG + Intergenic
915579911 1:156807376-156807398 CCTAGGAGGCAGAGGGTAGAGGG - Intronic
915817107 1:158979878-158979900 ACTTAAAGGTCGAGGGTGGGAGG - Intergenic
915946644 1:160157333-160157355 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
916593713 1:166221013-166221035 ACTTGAAGGCAGAAGGTGGGAGG - Intergenic
916708373 1:167377815-167377837 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
916741056 1:167647343-167647365 CTTTGAAGGCTGAGGCAGGGTGG + Intronic
916967303 1:169963097-169963119 ACTTAAGGGTAGAGGGTGGGAGG - Intronic
917071006 1:171150776-171150798 GCTTGACAGTAGAGGGTGGGAGG + Intronic
917253559 1:173089332-173089354 ACTTGAGGGAGGAGGGTGGGAGG - Intergenic
917306045 1:173626618-173626640 TCTTGAAGGCAGTCGGGGGGTGG - Intronic
917585216 1:176419270-176419292 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
917863085 1:179166699-179166721 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
918165099 1:181937341-181937363 CCTTGAGGGTGGAAGGTGGGAGG + Intergenic
918272566 1:182916885-182916907 ACTTGAAGGTAGAGGGTGGGAGG + Intronic
919035128 1:192297008-192297030 ACTTGAAGATAGAGGATGGGAGG - Intergenic
919093863 1:193006160-193006182 GCTTGAGGGTAAAGGGTGGGAGG + Intergenic
919221643 1:194638277-194638299 CCTGGAAGGCGGAGGGTGGGAGG - Intergenic
919452989 1:197792686-197792708 ACTTGAGGGCAGAGGATTGGAGG - Intergenic
919483942 1:198122888-198122910 CTTTGCTGGCAGAGGGTAGGAGG + Intergenic
920007574 1:202844688-202844710 CCTGGGAGGCAGAGGTTGTGGGG - Intergenic
920208540 1:204311413-204311435 CCTGGGAGGCAGAGGTTGTGGGG + Intronic
920531035 1:206702752-206702774 CCTGGAAGGCAAAGTGTGGAAGG - Intronic
920537924 1:206752413-206752435 CCTGGAGGGTGGAGGGTGGGAGG - Intergenic
920667963 1:207980191-207980213 CCTTGGAGGCAGAGGTTGCAGGG - Intergenic
920763020 1:208804115-208804137 ACTTGAGGGCGGTGGGTGGGAGG - Intergenic
920870879 1:209793715-209793737 CCTTGAGGACGGAGGGTGGGAGG - Intronic
921236650 1:213138505-213138527 CTTTGAGGGTAAAGGGTGGGAGG - Intronic
921336193 1:214088994-214089016 GCTTGAGGGTGGAGGGTGGGAGG - Intergenic
922052363 1:222005644-222005666 ACTTGAAGGTGGAGGGTAGGTGG - Intergenic
922163536 1:223096324-223096346 ACTTGAGGGTAGAAGGTGGGAGG - Intergenic
922182769 1:223248359-223248381 TCCTGCAGGCAGAGGTTGGGTGG - Intronic
922195883 1:223360243-223360265 CCTTGAAGCCTGGGGGTGGGGGG + Intronic
922229464 1:223673198-223673220 ACTTGCAGGTAGAGGGTGGGAGG + Intergenic
922239249 1:223744783-223744805 CCTGGGAGGCAGAGGTTGGGAGG + Intronic
922732698 1:227959507-227959529 CACTGAAGGTAGAGGCTGGGAGG + Intergenic
923179521 1:231502798-231502820 ACTTGAAGGTGGAGGCTGGGAGG - Intergenic
923189547 1:231607239-231607261 ACTTGAGGGTGGAGGGTGGGTGG - Intronic
923383537 1:233444868-233444890 GCTTGAGAGAAGAGGGTGGGAGG + Intergenic
923535390 1:234846499-234846521 ACCTGAAGGTGGAGGGTGGGAGG - Intergenic
923822036 1:237455413-237455435 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
924212967 1:241789728-241789750 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
924314023 1:242776939-242776961 ACCTGAGAGCAGAGGGTGGGAGG + Intergenic
924463204 1:244277689-244277711 CCTTGAGAGTGGAGGGTGGGAGG - Intergenic
924686707 1:246299830-246299852 ACTTGAAGGTGGAGGATGGGAGG + Intronic
1062895555 10:1100818-1100840 CCTTGAAGGCAGGGGGTGATGGG - Intronic
1063153167 10:3355125-3355147 CTCTGAAGGCAGGGGGTGGCTGG - Intergenic
1063269963 10:4497296-4497318 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1063382450 10:5594341-5594363 TCTGCAAGGCAGAGGGAGGGAGG - Intergenic
1063448040 10:6132458-6132480 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
1063526842 10:6795100-6795122 GCTTGATGGGGGAGGGTGGGAGG + Intergenic
1063773265 10:9228919-9228941 CCTGGAGGGAAGAGAGTGGGTGG - Intergenic
1063776327 10:9269165-9269187 ACTCGAAGGTGGAGGGTGGGAGG + Intergenic
1064033157 10:11895617-11895639 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1064102363 10:12474743-12474765 GCTTGAGGGTAGAGGGTGGGAGG - Intronic
1064487044 10:15804206-15804228 GCTTAAATGCAGAGGGTTGGCGG + Intronic
1064621318 10:17220405-17220427 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1064772410 10:18737155-18737177 ACTTGAAGGTAGAGGGTGGGAGG + Intergenic
1064912820 10:20421591-20421613 ACTTAACGGTAGAGGGTGGGAGG - Intergenic
1065178891 10:23105445-23105467 CCTGGAAAGCAGGGGGTAGGGGG - Intronic
1065201759 10:23319151-23319173 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1065445833 10:25797616-25797638 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1065563310 10:26984881-26984903 CCCTGAAGACTGAGGGTGGTAGG + Intergenic
1065628610 10:27655188-27655210 CATTGGAGGCTGAGGGTGGGAGG + Intergenic
1065652978 10:27913277-27913299 ACTTGAAGATGGAGGGTGGGAGG - Intronic
1065860417 10:29867876-29867898 ACTTGAGGGTAGAGGATGGGAGG - Intergenic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1065980327 10:30888524-30888546 ACTTGAGGGTAGAGGGTGGAGGG - Intronic
1066174164 10:32886638-32886660 ACTTGAGGGGGGAGGGTGGGAGG + Intergenic
1066559885 10:36658686-36658708 CCTGGGAGGCAGAGGTTGCGGGG + Intergenic
1066656111 10:37701201-37701223 CCTGTGAGGCAGAGGGTGGGGGG - Intergenic
1066659447 10:37726328-37726350 CGTTGCAAGAAGAGGGTGGGGGG - Intergenic
1067162647 10:43840372-43840394 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1067222271 10:44352793-44352815 CCTTTAAGACAGAGGGTCAGAGG - Intergenic
1067340846 10:45402248-45402270 CCTTGACAGCAGTGGGTGGCTGG - Intronic
1067789693 10:49278390-49278412 CCTGGAAGGCAGATGGGGAGTGG - Intergenic
1067834390 10:49629152-49629174 CCTTATAGGCAGTGGGTAGGAGG - Intronic
1067915363 10:50392027-50392049 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1068086578 10:52381090-52381112 ACTTGAGGGTAGAAGGTGGGAGG - Intergenic
1068397681 10:56485488-56485510 ACTTGAAGGTGGAGGATGGGAGG - Intergenic
1068427921 10:56891740-56891762 CCTGGGAGGCAGAGGTTGGGAGG - Intergenic
1068685371 10:59865403-59865425 CCTTGCCGGGAAAGGGTGGGAGG - Intronic
1068708472 10:60104073-60104095 ACTTGAAGGTGGAGGGTAGGAGG + Intronic
1068850798 10:61737800-61737822 ACTTGAAGCAGGAGGGTGGGAGG + Intronic
1068891287 10:62150743-62150765 ACTTGAAGGGACAGGGTAGGAGG - Intergenic
1069438804 10:68409193-68409215 ACTTGAAGGTGGAGGATGGGAGG - Intergenic
1069915129 10:71782634-71782656 CCTTGAAGGCTCAGGGAGGCAGG - Intronic
1069964379 10:72101981-72102003 CCTTGAGGGTGGAGGGAGGGAGG + Intronic
1070802740 10:79253080-79253102 GCTGGAAGGCAGTGGGTGTGCGG + Intronic
1070871128 10:79754453-79754475 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1071214796 10:83388285-83388307 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1071343550 10:84669936-84669958 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1071367985 10:84920361-84920383 ACTTGAGGGCAGAGGGTGGGAGG + Intergenic
1071379042 10:85039313-85039335 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
1071418979 10:85470061-85470083 ACTTCAGGGTAGAGGGTGGGAGG + Intergenic
1071638062 10:87276661-87276683 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1071657182 10:87461291-87461313 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1071757800 10:88564420-88564442 CCTGAAAATCAGAGGGTGGGGGG + Intronic
1071820225 10:89272243-89272265 ACTGGAGGGCAGGGGGTGGGAGG - Intronic
1072422160 10:95297965-95297987 AGTTGAAGGCAGAGGCTAGGTGG - Intergenic
1072839794 10:98759180-98759202 ACTTGAGGGTAGAGTGTGGGAGG + Intronic
1072903807 10:99432058-99432080 ACTTGAGGCTAGAGGGTGGGAGG - Intergenic
1073049269 10:100656949-100656971 CCCTAGAGGCGGAGGGTGGGGGG + Intergenic
1073059793 10:100726544-100726566 TCTGGAAGGCAGGGGGTGGGGGG + Intergenic
1073564727 10:104525405-104525427 CCTTGAGAGCAGAGGATGAGGGG - Intergenic
1073832297 10:107399146-107399168 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1073863731 10:107776544-107776566 ACTTGAGGGTAGAGGATGGGAGG + Intergenic
1074864213 10:117535553-117535575 ACTGGAAGGCGGAGGGTGGTCGG - Intergenic
1075170527 10:120109447-120109469 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1075253901 10:120908741-120908763 CCTGGAAGGCAGATGGGAGGGGG + Exonic
1075333051 10:121588236-121588258 ACTTGAGGGTGGAGGGTGGGTGG + Intronic
1075543429 10:123335298-123335320 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1076025270 10:127107063-127107085 CTTTGAAGGCAGAGGCGGGAGGG - Intronic
1076091087 10:127686281-127686303 CTTGGAAAGCAGAAGGTGGGTGG + Intergenic
1076343492 10:129765552-129765574 GATTGAAGGCAGGGGGTGGGGGG + Intronic
1076469668 10:130709799-130709821 CCTATAGGGCAGAGAGTGGGAGG - Intergenic
1076540314 10:131210332-131210354 CCCTGGGGGCAGAGGGTTGGGGG - Intronic
1076653919 10:132008621-132008643 CCTGGGAGGCAGAGGTTGTGGGG + Intergenic
1076662885 10:132067261-132067283 TCTCCAAGGCTGAGGGTGGGGGG + Intergenic
1076732285 10:132444832-132444854 CCTTGGAGCCCCAGGGTGGGCGG - Intronic
1076830535 10:132992224-132992246 CCTCGAGGACAGAGGGTGGACGG + Intergenic
1076921273 10:133455916-133455938 CTTGGGAGGCAGAGAGTGGGTGG + Intergenic
1077021346 11:418453-418475 CATGGAAGGCAGAGGCTGGGTGG - Exonic
1077609899 11:3637594-3637616 CCTAGGAGGGTGAGGGTGGGGGG + Intergenic
1077671584 11:4162620-4162642 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1077784166 11:5364768-5364790 TCAGGAAGGAAGAGGGTGGGGGG - Intronic
1077955161 11:7010415-7010437 ACTTGAAGGTAGAGGGTGAGAGG + Intronic
1078187085 11:9061249-9061271 CTTTAAAGGCTGGGGGTGGGGGG + Intronic
1078340460 11:10495069-10495091 CTCTGAAGGCAGATGTTGGGAGG - Intronic
1078370563 11:10741173-10741195 ACTTGAGGGTTGAGGGTGGGAGG + Intergenic
1078946863 11:16077802-16077824 ACTTGAAGGCAGAGAGTAAGAGG + Intronic
1079002598 11:16770363-16770385 AATGGAAGGCAGAGGGTGGAGGG + Intergenic
1079101320 11:17544017-17544039 CCTGGAAGGCAGAGGGAGAAAGG + Intronic
1079285419 11:19126272-19126294 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1079343803 11:19634333-19634355 ACTTGAAGGTGGAGGGTGGGAGG + Intronic
1079479670 11:20866049-20866071 CCTTGAAGGCAGGGGGCAGGAGG - Intronic
1079495073 11:21033382-21033404 ACTTGGAGGTGGAGGGTGGGAGG - Intronic
1079645558 11:22860485-22860507 GCTTGAAGGCTGTGGGTGTGGGG - Intergenic
1079728451 11:23907609-23907631 ACTTGAGGGCAGAGGGTGGGAGG + Intergenic
1079779265 11:24578767-24578789 ACTAGAAGGCAGAAGGAGGGAGG + Intronic
1079803934 11:24905450-24905472 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
1080249219 11:30214186-30214208 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1080398629 11:31913524-31913546 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
1080724491 11:34881926-34881948 ACTTGATGGCGGAGGGTGGGAGG + Intronic
1080777377 11:35398506-35398528 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1081088799 11:38835560-38835582 CCCGGAGGGCAGAGGGTGAGAGG + Intergenic
1081508837 11:43747390-43747412 CTTTGATGGAAGAGGGTAGGAGG + Intronic
1081530054 11:43952219-43952241 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
1081580226 11:44346867-44346889 GCATGAGGGCAGAGGGAGGGAGG - Intergenic
1081669386 11:44934747-44934769 CCAGGGAGGCAGGGGGTGGGGGG - Exonic
1081699816 11:45146115-45146137 CCGCGAAGGCTGAGGGTGAGGGG - Intronic
1082107825 11:48239916-48239938 ACTTGAGGGGGGAGGGTGGGTGG - Intergenic
1082116073 11:48329567-48329589 ACTAGAAGGTAGAGGGTGGAAGG + Intergenic
1082701542 11:56438002-56438024 ACTTGAGGGCAGAGGGTGAGAGG - Intergenic
1082712060 11:56565097-56565119 TCTTGAGGGGGGAGGGTGGGAGG - Intergenic
1082783284 11:57302782-57302804 CCTGGGAGCCGGAGGGTGGGGGG + Exonic
1082981455 11:59127229-59127251 ACTTGAGGGTGGAGGGTGGGAGG + Exonic
1083297451 11:61722695-61722717 CCTGGGAGGCGGGGGGTGGGGGG + Intronic
1083408740 11:62477353-62477375 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1083495253 11:63046569-63046591 ACTTGAAGGTGGAGAGTGGGAGG + Intergenic
1083623406 11:64059879-64059901 CCTTGAAGGCCGAGGAGGCGAGG + Intronic
1083677766 11:64336549-64336571 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1083729144 11:64643538-64643560 GCTGGAAGGGAGAGGGAGGGAGG + Intronic
1083816827 11:65137547-65137569 CCTGAAGGGCAGAGTGTGGGAGG - Intergenic
1084164670 11:67370001-67370023 CGTTGCAGGCTGCGGGTGGGGGG + Intronic
1084390832 11:68875661-68875683 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1084938628 11:72600705-72600727 CCTGGAAGGCAGGGTGGGGGTGG - Intronic
1084984173 11:72852985-72853007 ACTTGAAGGCAGAAGGTGGGAGG + Intronic
1085312622 11:75525450-75525472 TCGTGAAGCCAGAGGCTGGGGGG + Exonic
1085655078 11:78306698-78306720 TCTTGAAGGCAGAGAGTGAAAGG + Intronic
1085914225 11:80865505-80865527 ACTTGAGGGTAGAAGGTGGGAGG + Intergenic
1086164640 11:83763323-83763345 ACTTGATGGTGGAGGGTGGGAGG - Intronic
1086372251 11:86166667-86166689 ACTAGAAGGTGGAGGGTGGGAGG + Intergenic
1086381329 11:86258092-86258114 ACTGGAGGGTAGAGGGTGGGAGG - Intronic
1086526399 11:87732234-87732256 ACTTGAGGGTGGAGGGTGGGGGG - Intergenic
1086592179 11:88527928-88527950 CCATGAGGGTGGAGGGTGGGAGG + Intronic
1086664192 11:89459292-89459314 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1087360382 11:97151272-97151294 ACTTGAAGGTGGAGGGAGGGAGG - Intergenic
1087440364 11:98176230-98176252 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1087466685 11:98516827-98516849 ACTTGAAGGCGGAGGGTGGTAGG - Intergenic
1087512775 11:99119290-99119312 ACTTGAAGGTGGAGGGTGGAAGG - Intronic
1087842824 11:102937515-102937537 ACTTGAGGGAGGAGGGTGGGAGG + Intergenic
1087978090 11:104575404-104575426 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
1088420358 11:109638358-109638380 ACTTGAGGGGGGAGGGTGGGAGG - Intergenic
1088442426 11:109886205-109886227 ACTTGAGGGTAAAGGGTGGGAGG + Intergenic
1088505916 11:110526776-110526798 ACTTGAAGGTACAAGGTGGGAGG - Intergenic
1088928323 11:114324336-114324358 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
1089033189 11:115355460-115355482 ACTTGAGGGTAGAGGCTGGGAGG + Intronic
1089387304 11:118076816-118076838 CCTAGAAGGTAGGGGGAGGGGGG + Intergenic
1089491406 11:118886463-118886485 TCTTTAAGGCAGGGGCTGGGGGG + Intronic
1089630315 11:119780124-119780146 CCCTGGAGGCAGGGGCTGGGGGG + Intergenic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1089821730 11:121234569-121234591 CCTTGAGGGCAAATGGGGGGAGG - Intergenic
1089884897 11:121810769-121810791 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1090115851 11:123972304-123972326 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
1090444537 11:126752633-126752655 CTTGGGAGGCAGTGGGTGGGGGG - Intronic
1090538030 11:127667398-127667420 GCTTGAGGGTGGAGGGTGGGAGG + Intergenic
1090591430 11:128274356-128274378 ACTGGAGGGTAGAGGGTGGGAGG - Intergenic
1090630805 11:128645649-128645671 TCTTGAAGGGAGAGGGTGTGAGG + Intergenic
1090667662 11:128925486-128925508 CATGAAAGGGAGAGGGTGGGAGG - Intergenic
1091723582 12:2830608-2830630 CCCTGATGGGAGAGGGAGGGAGG - Intronic
1091815866 12:3437514-3437536 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
1091829034 12:3536236-3536258 CCCTGAAGGCTGGGAGTGGGTGG - Intronic
1091960689 12:4691718-4691740 CCCTGGAAGCAGAGGGTGGTGGG + Exonic
1092579821 12:9826866-9826888 ACTTGAAGGTGGAGGGTGAGAGG + Intergenic
1092581007 12:9841307-9841329 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1092775657 12:11943299-11943321 CCTTGAAGGCAGAGGCCATGGGG - Intergenic
1092813710 12:12294752-12294774 GCAGGAAAGCAGAGGGTGGGAGG - Intergenic
1092889837 12:12958985-12959007 ACTTGAGGGGAGAGGGTGGGAGG - Intergenic
1092936867 12:13372232-13372254 TCTTGAGGCCAGAGGGTAGGAGG + Exonic
1093030329 12:14282639-14282661 ACCTGAGGGCGGAGGGTGGGAGG + Intergenic
1093097791 12:14991752-14991774 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1093275077 12:17116049-17116071 ACTTGAAGCAAGAGGTTGGGAGG + Intergenic
1093497387 12:19774176-19774198 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
1093686028 12:22054873-22054895 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
1093787832 12:23213306-23213328 ACTTGAGGGTAGAGGGTTGGAGG - Intergenic
1093968601 12:25353313-25353335 ACTCGAGGGTAGAGGGTGGGAGG + Intergenic
1094030123 12:26002348-26002370 GCTTGAACCCAGAGGGTGGAGGG + Intronic
1094142745 12:27198037-27198059 CCAGGATTGCAGAGGGTGGGAGG - Intergenic
1094171125 12:27493174-27493196 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1094226012 12:28046970-28046992 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1094284811 12:28781270-28781292 GCTTGAAGGCACGGGGTTGGAGG - Intergenic
1094817174 12:34199580-34199602 ACTTGAAGGCGGAGGGTGGGAGG + Intergenic
1095090916 12:38103947-38103969 ATTTGAAGTTAGAGGGTGGGAGG - Intergenic
1095099842 12:38169134-38169156 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
1095311455 12:40702518-40702540 CCTGGGAGGCAGAGGTTGCGGGG - Intronic
1095540962 12:43308107-43308129 ACTTGAAGGCGGAGGGTGGGAGG - Intergenic
1095728724 12:45481065-45481087 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1095836384 12:46643878-46643900 TCTTGAGGGTAGAGGGTGGGAGG + Intergenic
1095842906 12:46714017-46714039 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1095846364 12:46749673-46749695 CCTTGAGGGTGAAGGGTGGGAGG + Intergenic
1096021696 12:48330307-48330329 CCTGGAAGGGAAGGGGTGGGTGG + Intergenic
1096042983 12:48536233-48536255 ACTTGAGAGCAGAGGGAGGGAGG + Intergenic
1096527152 12:52217246-52217268 CCTTGAAGGCTCAGGGAAGGAGG - Intergenic
1097170527 12:57110327-57110349 CCTTGAAGGGGAAGGGAGGGAGG + Intronic
1097829922 12:64213568-64213590 CCTTGTAGGAAAAGGGGGGGAGG - Intronic
1098663618 12:73131662-73131684 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1098872182 12:75828887-75828909 GGTGGAAGGTAGAGGGTGGGAGG - Intergenic
1098904889 12:76151664-76151686 CCTGGGAGGCAGAGGGAGGTTGG + Intergenic
1098989913 12:77054069-77054091 ACTTGAGGGTAGAGGGTGAGAGG + Intronic
1099372030 12:81846091-81846113 TCTTGAGGGTGGAGGGTGGGAGG - Intergenic
1099603229 12:84768295-84768317 ACTGGAGGGCGGAGGGTGGGAGG - Intergenic
1099771434 12:87063605-87063627 ACTTGAAGATGGAGGGTGGGAGG - Intergenic
1099789687 12:87317320-87317342 CTCTGTAGGCAGAGGGTGCGGGG + Intergenic
1100001767 12:89845178-89845200 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1100261035 12:92932206-92932228 ACTTGAAGGCAGGAGGTGGATGG + Intergenic
1100637997 12:96454172-96454194 CCTTGAGGGTGGAAGGTGGGAGG + Intergenic
1100675065 12:96857286-96857308 ACTTGAGGGTAGAAGGTGGGAGG - Intronic
1100836467 12:98571474-98571496 CCTGGGAGGCAGAGGCTGTGTGG - Intergenic
1100928624 12:99580190-99580212 ACTTGAGGGTAGAGGGTTGGAGG + Intronic
1101120958 12:101579690-101579712 CCTGGGAGGCAGAGGTTGTGGGG - Intronic
1101759106 12:107644724-107644746 GCTTGAGGGTAAAGGGTGGGAGG - Intronic
1102027701 12:109722986-109723008 GCTTGGAGGGAGCGGGTGGGGGG + Intronic
1102446478 12:113006860-113006882 CCTTGCCTACAGAGGGTGGGTGG + Intronic
1102860100 12:116328866-116328888 ACTTGTAGGTAGAGGATGGGAGG + Intergenic
1103032965 12:117632684-117632706 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1103254261 12:119527259-119527281 CCTTGAGGGGGGATGGTGGGAGG + Intronic
1103293107 12:119863357-119863379 ACTAGAGGACAGAGGGTGGGAGG + Intronic
1103495243 12:121357054-121357076 CTTGGGAGGCCGAGGGTGGGAGG + Intronic
1103565432 12:121812947-121812969 CTTTGAAGGCTGAGGGGGAGTGG - Intronic
1103609493 12:122114061-122114083 CCTGGGAGGCAGAGGTTGCGCGG - Intronic
1104054108 12:125216262-125216284 TCCTAAAGGTAGAGGGTGGGTGG + Intronic
1104155783 12:126130393-126130415 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1104537373 12:129630851-129630873 GCTTGAGGGTGGAGGGTGGGTGG - Intronic
1104595410 12:130117026-130117048 CCAGCAGGGCAGAGGGTGGGCGG + Intergenic
1105400088 13:20084118-20084140 CTCAGGAGGCAGAGGGTGGGAGG - Intronic
1105711556 13:23014363-23014385 ACTTGAGGGTAGAGAGTGGGGGG - Intergenic
1105716612 13:23071895-23071917 GCTTGAGGATAGAGGGTGGGAGG - Intergenic
1106314774 13:28583724-28583746 CCAGGAAGGCAGAGGCTGAGAGG + Intergenic
1106318428 13:28616050-28616072 GCTTGAAGTTGGAGGGTGGGAGG - Intergenic
1106363580 13:29055515-29055537 ACTTGAGGGTAGAAGGTGGGAGG - Intronic
1106680664 13:32003869-32003891 ACTTGACGGCAGAGGGTGGGAGG + Intergenic
1106742026 13:32654681-32654703 TCTTGACGGTGGAGGGTGGGAGG - Intronic
1106963554 13:35031794-35031816 ATTTGAAGGTGGAGGGTGGGAGG - Intronic
1107014544 13:35697554-35697576 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1107246637 13:38304789-38304811 CCTTGAAGACAGAGGTTGGATGG - Intergenic
1108167662 13:47709955-47709977 CCACAGAGGCAGAGGGTGGGTGG - Intergenic
1108300436 13:49068898-49068920 ACCTGAAGGTGGAGGGTGGGAGG + Intronic
1108467882 13:50736347-50736369 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1108505806 13:51111298-51111320 CCTGGAAGGCAGATGGTGCGAGG - Intergenic
1108756676 13:53511331-53511353 ACTTGAAGGTGGAGGGTGAGAGG - Intergenic
1108807806 13:54181413-54181435 ACTTGTGGGCAGAGGGTGGGAGG - Intergenic
1108992334 13:56675980-56676002 CCCTGAAAGCAGAGGGTAGCAGG - Intergenic
1109081348 13:57905299-57905321 ACTGGAGGGCAGAGGGTGGAAGG + Intergenic
1109198626 13:59407002-59407024 ACTTGAGGGCAGAGGGTAGAAGG - Intergenic
1109254944 13:60068643-60068665 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1109589621 13:64460941-64460963 ACTTGAGGGCGGAGGGTGGGAGG - Intergenic
1109628898 13:65017794-65017816 GCTTGAAGGTGGAGGATGGGAGG - Intergenic
1109817700 13:67607574-67607596 CATTGAGGGTGGAGGGTGGGAGG + Intergenic
1110053932 13:70940834-70940856 CTTTGAAGGCTGAGGGTGGGAGG + Intergenic
1110061021 13:71038218-71038240 ACTTGAAGGTACAGGGTGAGAGG + Intergenic
1110069326 13:71153650-71153672 ACTTGAGGATAGAGGGTGGGAGG - Intergenic
1110172818 13:72522912-72522934 CCTTGAGGGGTGGGGGTGGGTGG - Intergenic
1110313390 13:74076791-74076813 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1110421173 13:75310797-75310819 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
1110442720 13:75543171-75543193 ACTTGAGGGTAGAGAGTGGGAGG + Intronic
1110482089 13:75990544-75990566 ACTTGAGGGCAGAGGGTGGGAGG + Intergenic
1110811549 13:79816803-79816825 ACTTGAGGGTAGAGAGTGGGAGG - Intergenic
1110825731 13:79969603-79969625 ACTGGAGGGCGGAGGGTGGGAGG - Intergenic
1110866465 13:80401639-80401661 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1110875245 13:80501566-80501588 ACTTGAGGGCGGAGGGTGAGAGG + Intergenic
1111101409 13:83593172-83593194 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1111260906 13:85738449-85738471 ACTGGAGGGGAGAGGGTGGGAGG + Intergenic
1111449908 13:88401510-88401532 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1111450858 13:88413385-88413407 ACTGGAGGGCAGAGGGTGGGAGG + Intergenic
1111492060 13:88991966-88991988 ACTTGAAGGTTGAAGGTGGGAGG + Intergenic
1111892378 13:94099956-94099978 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1111976014 13:94968004-94968026 CCTCGGAGGCTGCGGGTGGGCGG - Intergenic
1112227397 13:97553282-97553304 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1112259697 13:97867262-97867284 ACTTGAAGGAAGAGTGTGTGTGG - Intergenic
1112351372 13:98637464-98637486 CCTTGAGGGTGGAGGGTGAGAGG - Intergenic
1112364600 13:98746023-98746045 ACTTGAGGGTAGAGGGTAGGAGG - Intronic
1112558197 13:100488528-100488550 CCTTGGAGGCTGAGGCTGGAGGG + Intronic
1112782697 13:102918579-102918601 ACTTGAGGGTAAAGGGTGGGAGG - Intergenic
1112783233 13:102924995-102925017 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1112866392 13:103906262-103906284 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1112912577 13:104506294-104506316 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1112916600 13:104558742-104558764 ACTTGATGGTGGAGGGTGGGAGG - Intergenic
1112922296 13:104628811-104628833 CCTACAAAGCAGAGGGGGGGGGG - Intergenic
1112971906 13:105272003-105272025 ACTTGAGGGCGGAGGGTGGGAGG - Intergenic
1113007814 13:105727209-105727231 CCTTGATGGAGGAGGGTGGAGGG - Intergenic
1113053518 13:106240894-106240916 CCCTGAGGGTTGAGGGTGGGAGG + Intergenic
1113106279 13:106775054-106775076 CCTGGGAGGAAGAGAGTGGGAGG - Intergenic
1113182831 13:107650918-107650940 ACTTGACGGGGGAGGGTGGGAGG + Intronic
1113247795 13:108417963-108417985 ACTTGAGGGTGGAGGGTGGGTGG - Intergenic
1113259403 13:108545152-108545174 CCCTGAGGGTAGAGGATGGGAGG - Intergenic
1113320240 13:109225938-109225960 CCTAGAACTCAGAGGGCGGGGGG + Intergenic
1113358584 13:109607179-109607201 ACCTGAGGGTAGAGGGTGGGAGG - Intergenic
1113363259 13:109651546-109651568 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1113882415 13:113635153-113635175 CATTGAGTGCTGAGGGTGGGCGG + Intronic
1113988254 13:114336826-114336848 ACTTGAGGGGGGAGGGTGGGAGG + Intergenic
1114147700 14:19995936-19995958 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1114735403 14:25038656-25038678 ACTTGATGGCAGAGGGTAGGAGG + Intronic
1114856937 14:26458661-26458683 CCCAGAAGGGAGAGGTTGGGAGG + Intronic
1114902533 14:27082424-27082446 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1114914595 14:27247152-27247174 AATTGAGGGCGGAGGGTGGGGGG + Intergenic
1114938596 14:27576530-27576552 TCTTGAAGGCAGAAGATGGATGG - Intergenic
1115464737 14:33702702-33702724 CCTGAAGGGGAGAGGGTGGGAGG + Intronic
1116050562 14:39797688-39797710 CCTGGAAGGCAGAGGTTGCATGG - Intergenic
1116165829 14:41332951-41332973 CCATGAAGGCAGCGGGAGGGAGG - Intergenic
1116237539 14:42298038-42298060 CCTGGAAGGCAGAGTGTTGCAGG - Intergenic
1116269324 14:42741422-42741444 CCTTGCAGGCAGGGGGTGGGGGG - Intergenic
1116282179 14:42923421-42923443 ACTTGAAGATAGAGAGTGGGAGG - Intergenic
1116521871 14:45858655-45858677 CCTTGAGGTTTGAGGGTGGGAGG - Intergenic
1116578611 14:46608782-46608804 ACTTGAAGGTAGAGGGTGGGAGG - Intergenic
1116592399 14:46795052-46795074 ACATGAGGGCAGAGGGTGGGAGG - Intergenic
1116648350 14:47559235-47559257 ACTTGATGGTAGAGGGAGGGAGG - Intronic
1116683170 14:48003007-48003029 GCTTGAAGGGTGAGGGTGGAGGG + Intergenic
1116712296 14:48383645-48383667 CCTTATAGGCACAGGATGGGGGG + Intergenic
1116805232 14:49488076-49488098 ACTTGAGGGTAGAGGGTGGAAGG - Intergenic
1116816611 14:49590031-49590053 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1116846815 14:49872363-49872385 CCTTGGAGGCTGGAGGTGGGAGG - Intergenic
1116931665 14:50696889-50696911 CCTTGAGAGTGGAGGGTGGGAGG - Intergenic
1117043106 14:51785963-51785985 CCTTGAGGGTAGAAGGTGGGAGG - Intergenic
1117451824 14:55858609-55858631 ACTTGAAGGTAGACGGTGGGAGG - Intergenic
1117526509 14:56611975-56611997 ACTTAAGGGCAGAGGGTAGGAGG + Intronic
1117640680 14:57795946-57795968 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1117686017 14:58254050-58254072 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1118198519 14:63650499-63650521 CTTTGAAACCAGAGGGTGGGTGG + Intergenic
1118536035 14:66765606-66765628 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1118673156 14:68152749-68152771 ACTTGAAGGAAGAGAGTGGGAGG - Intronic
1118725884 14:68628688-68628710 GCGTGGAGGCAGAGGGTAGGGGG + Intronic
1119413718 14:74455770-74455792 TCTGGAAGGGAGAGGATGGGAGG - Intergenic
1119489867 14:75022159-75022181 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1120030878 14:79639362-79639384 ACTTGAGGGTAGAGGGTAGGAGG - Intronic
1120153227 14:81061633-81061655 GCTTGAAGGCAGAGGGTGGGAGG + Intronic
1120184545 14:81380817-81380839 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1120247737 14:82026313-82026335 CCTTGAAGGAAGAAAGTGAGTGG + Intergenic
1120376458 14:83713942-83713964 CAGTGAAGGCAGAGGATGGTGGG - Intergenic
1120820269 14:88905806-88905828 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1121273146 14:92651261-92651283 CATTGATGACACAGGGTGGGGGG - Intronic
1121729699 14:96177881-96177903 GCTTGAAGGCAGAGTTTAGGAGG + Intergenic
1121942488 14:98085448-98085470 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1121971616 14:98362335-98362357 CCTAGAAGGCAGAGGCCGGTGGG + Intergenic
1122036429 14:98952452-98952474 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1122060453 14:99133627-99133649 CGCTGAGTGCAGAGGGTGGGTGG - Intergenic
1122167245 14:99837074-99837096 ACTTGAGGGCAGGGTGTGGGAGG + Intronic
1122180736 14:99952789-99952811 CCTGGAAGGGAAGGGGTGGGGGG - Intergenic
1122575642 14:102739814-102739836 ACATGAAGGCAGAGGCTGGCAGG + Intergenic
1122688042 14:103519160-103519182 GCCTGAAGGCCGAGGCTGGGAGG + Intergenic
1122972025 14:105156209-105156231 CCCTAAACGCAGAGGGTCGGGGG + Intronic
1123419235 15:20118052-20118074 CTTTGAGGGTAGAGGGTGGGAGG + Intergenic
1123446630 15:20335447-20335469 CTTTGAGGGTAGAGGGTGGGAGG - Intergenic
1123528457 15:21124595-21124617 CTTTGAGGGTAGAGGGTGGGAGG + Intergenic
1123769660 15:23516089-23516111 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1123889434 15:24761443-24761465 ACCTGAGGGTAGAGGGTGGGAGG + Intergenic
1123917385 15:25046411-25046433 ACTTGAAGGTAGAAGGTGGGAGG - Intergenic
1124113120 15:26811496-26811518 ACCTGAAGGTGGAGGGTGGGAGG + Intronic
1124136282 15:27038743-27038765 CCAGAAAGGCAGAGGGTAGGGGG + Intronic
1124153417 15:27203191-27203213 ACTTGAAGGTGGAGGGTGGAAGG - Intronic
1124373233 15:29115237-29115259 CCTTGCAGCCTGTGGGTGGGCGG + Intronic
1124412804 15:29450947-29450969 ACTTGAGAGAAGAGGGTGGGAGG + Intronic
1124624516 15:31300346-31300368 ACGTGACAGCAGAGGGTGGGTGG - Intergenic
1124681566 15:31736056-31736078 ACTGGAGGGCAGAGGGTGGGAGG + Intronic
1124690741 15:31820299-31820321 CTTTGAAGGCAAATGGTGTGTGG - Intronic
1125443608 15:39729882-39729904 ACTTGAGGGCAGAGGGTGGTAGG + Intronic
1125529172 15:40400572-40400594 ACTTGAGGGTGGAGGGTGGGTGG - Intergenic
1125601915 15:40919948-40919970 TCTGGAAAGCAGAGGGTGAGAGG + Intergenic
1125649813 15:41307381-41307403 CCTGGGAGGCAGAGGTTGTGGGG - Intergenic
1125780750 15:42264850-42264872 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1125889840 15:43257529-43257551 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1126223763 15:46245482-46245504 GCTTGATGGGGGAGGGTGGGAGG - Intergenic
1126283403 15:46983866-46983888 ACTTGAGGGCAGAGGGTGGAAGG - Intergenic
1126659302 15:51016449-51016471 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
1126703778 15:51389019-51389041 CCTTGAAGGCAGGGAATGAGAGG - Intronic
1126890550 15:53199790-53199812 CCTTGATGTTAGAAGGTGGGTGG + Intergenic
1126993338 15:54409525-54409547 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
1127202412 15:56670341-56670363 GCCAGAGGGCAGAGGGTGGGAGG - Intronic
1127245769 15:57172623-57172645 CCTTGAAGGTAGAGGGTGGGAGG + Intronic
1127372603 15:58355245-58355267 CCTTGAAGGCAGATGGGGAGTGG - Intronic
1127385330 15:58462207-58462229 CTTTGAAGGCAGAGAGAGGCTGG + Intronic
1128046552 15:64623018-64623040 CCTTGAAGGCATCGTGTGGCAGG + Exonic
1128423755 15:67519744-67519766 CTTGGGAGGCTGAGGGTGGGAGG + Intergenic
1128602764 15:69011597-69011619 CCCTGAAGAAAGAAGGTGGGGGG - Intronic
1129012916 15:72439209-72439231 CCCGGAAGGCAGAGGTTGCGGGG + Intergenic
1129081803 15:73047895-73047917 ACTTTAGGGTAGAGGGTGGGAGG - Intergenic
1129585420 15:76858613-76858635 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
1130028840 15:80294100-80294122 CCTGGGAGGCAGAGGTTGTGGGG - Intergenic
1130040369 15:80401226-80401248 CCTGGGAGGCAGAGGTTGTGGGG + Intronic
1130189459 15:81719099-81719121 ACTGGAAGGTGGAGGGTGGGAGG - Intergenic
1130672684 15:85926532-85926554 TCATGAAGGAAGAGAGTGGGAGG - Intergenic
1131531281 15:93194816-93194838 CCTGGAGGGTGGAGGGTGGGAGG - Intergenic
1131802291 15:96083908-96083930 CCTTGAGGAGAGAGGGTAGGTGG - Intergenic
1131956172 15:97738670-97738692 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1132200732 15:99953051-99953073 CTTTGATGGCAGAGGAAGGGAGG - Intergenic
1132242980 15:100275293-100275315 CATGAAAGGCAGGGGGTGGGGGG + Intronic
1132259274 15:100407945-100407967 CCTTGGAGGCAGAGGTTGCAGGG - Intronic
1132288645 15:100684145-100684167 CCTTGAGGGTGGAGGCTGGGAGG - Intergenic
1132297353 15:100749726-100749748 ACTTGAATGTTGAGGGTGGGAGG - Intergenic
1132297646 15:100753204-100753226 ACTAGAAGGGAAAGGGTGGGAGG + Intergenic
1132308335 15:100835183-100835205 CCTTGAGGGTGGAGGTTGGGAGG - Intergenic
1132392696 15:101450504-101450526 CCTTGAAGGCTTATGGTGGAGGG - Intronic
1132848212 16:2010504-2010526 TCTGGATGGCAGAGGGAGGGAGG - Intronic
1133113493 16:3563410-3563432 CCATGCAGGCAGAGGACGGGAGG - Exonic
1133378958 16:5313885-5313907 CTTTGGAGGCTGTGGGTGGGTGG + Intergenic
1133434409 16:5766788-5766810 CCTTGAGGGCAGAAGCAGGGTGG - Intergenic
1133454950 16:5933941-5933963 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1133481023 16:6170740-6170762 GCTTGAGGATAGAGGGTGGGAGG - Intronic
1134068475 16:11245685-11245707 CATTGAAGCCAGATGGCGGGGGG + Intergenic
1134284812 16:12851552-12851574 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1134564861 16:15242711-15242733 ACTTGAAGGTAGAGGATGGGAGG + Intergenic
1134737635 16:16513987-16514009 ACTTGAAGGTAGAGGATGGGAGG - Intergenic
1134929870 16:18198173-18198195 ACTTGAAGGTAGAGGATGGGAGG + Intergenic
1135246935 16:20864978-20865000 ACTTGAGGGTAGAGGGTGGAGGG + Intronic
1135346628 16:21694332-21694354 CCCTGGAGGCTGAGGGGGGGAGG + Intronic
1135461197 16:22644754-22644776 ACTTGAGGATAGAGGGTGGGAGG - Intergenic
1135481835 16:22827170-22827192 CCCTGAGGACAGAGGGTGGCTGG + Intronic
1135533007 16:23270638-23270660 GCTTGAGGGTGGAGGGTGGGAGG - Intergenic
1135952663 16:26929820-26929842 ACTTGAAGGTGGAGGGTGGCAGG - Intergenic
1136056868 16:27696490-27696512 TATTGAGGGCAGAAGGTGGGAGG - Intronic
1136412622 16:30086049-30086071 CTTTGAAGCCAGAGGGGGGTGGG + Exonic
1136752066 16:32649284-32649306 CCTTGTAGTCAAAGGGTTGGAGG - Intergenic
1137264803 16:46859927-46859949 CCTTGAATGAAGAGGAAGGGAGG - Intergenic
1137356617 16:47772321-47772343 CATTTAAGGCAGAGGGTAGAGGG - Intergenic
1137792597 16:51187455-51187477 ACTTCAAGGCAGAGGGCAGGAGG - Intergenic
1137837138 16:51603456-51603478 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1138275207 16:55729299-55729321 CCTTGAAGGCAGGGGCAGTGTGG - Intergenic
1138280398 16:55768554-55768576 CTTTGAAGGCAGGGGCTGCGTGG - Intergenic
1138288088 16:55825078-55825100 CCTTGAAGGCAGGGGCTGTGTGG + Intronic
1138724236 16:59118502-59118524 CCTTGTCTGCAGTGGGTGGGTGG + Intergenic
1139276472 16:65732485-65732507 ATTGGAAGGTAGAGGGTGGGAGG - Intergenic
1139352060 16:66343050-66343072 CTTTGAAGGCAGAGGAGGAGAGG - Intergenic
1139749473 16:69100543-69100565 CGTTAAGGGCAGAGGGTGAGGGG + Intergenic
1140018302 16:71210499-71210521 ACTTGAGGGAGGAGGGTGGGAGG + Intronic
1140421777 16:74825131-74825153 TCTGGGAGGCTGAGGGTGGGAGG - Intergenic
1140433041 16:74921241-74921263 ACTTGAGGACGGAGGGTGGGAGG - Intronic
1140572786 16:76128299-76128321 ACTTGAGAGCAGAGGGCGGGAGG - Intergenic
1141461279 16:84180028-84180050 CCTGGAAGGAAGAGACTGGGGGG + Exonic
1141671835 16:85496232-85496254 CCTTGGAGGCACGGGGTGGCGGG - Intergenic
1141673270 16:85504037-85504059 CGTGGGAGGCAGAGGGCGGGCGG - Intergenic
1142317835 16:89360051-89360073 ACTTGAGGGGAGAGGGCGGGAGG - Intronic
1142338151 16:89503625-89503647 TCTGGGAGGCCGAGGGTGGGTGG - Intronic
1203137859 16_KI270728v1_random:1740673-1740695 CTTTGAGGGTGGAGGGTGGGAGG - Intergenic
1142486132 17:248579-248601 CCCTGAACTCACAGGGTGGGAGG + Intronic
1142513281 17:411085-411107 CCTTAACGCAAGAGGGTGGGAGG - Intronic
1142755532 17:2014393-2014415 CCTTGAATGGGGAGAGTGGGGGG - Intronic
1142787091 17:2232829-2232851 TCTTGGAGGCAGAGGATGTGAGG - Intronic
1143272114 17:5683481-5683503 CGTGGAGGGCAGGGGGTGGGCGG + Intergenic
1143348460 17:6268121-6268143 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1143428167 17:6857018-6857040 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1143999983 17:11044749-11044771 TCTTGAAGGTGGAAGGTGGGGGG - Intergenic
1144383225 17:14723734-14723756 ACTTGAGGGTAGAGGGTGAGAGG + Intergenic
1144958889 17:19033756-19033778 CCTGGAAGGCATCAGGTGGGTGG + Intronic
1144976270 17:19140768-19140790 CCTGGAAGGCATCAGGTGGGTGG - Intronic
1145270757 17:21403702-21403724 TGATGAAGGGAGAGGGTGGGAGG + Intronic
1145277891 17:21445886-21445908 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1145308966 17:21691089-21691111 TGATGAAGGGAGAGGGTGGGGGG + Intergenic
1145315715 17:21731752-21731774 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1145763531 17:27442067-27442089 CCCGGGAGGCAGAGGTTGGGAGG + Intergenic
1146561140 17:33871598-33871620 ACTAGAATGGAGAGGGTGGGAGG - Intronic
1146744060 17:35313089-35313111 CCCTGATGACAGTGGGTGGGTGG + Intergenic
1146795043 17:35774725-35774747 GCTGGGAGGCAGAGGTTGGGTGG - Intronic
1147359258 17:39920998-39921020 CCTGGAAGGCTGAGGGGAGGGGG - Intergenic
1147384724 17:40074384-40074406 CCTGGGTGGCAGGGGGTGGGTGG + Exonic
1147390066 17:40103626-40103648 GTGTGAAGGCAGAGGCTGGGAGG + Intergenic
1147538967 17:41340682-41340704 CCCTGAGAGCAGAGGGTGTGTGG - Intergenic
1147542655 17:41373684-41373706 TCTGGAGGGTAGAGGGTGGGAGG - Intronic
1147955789 17:44133657-44133679 CCAGGAAGGCAGGAGGTGGGAGG - Intergenic
1148128649 17:45249349-45249371 CCTGGAAGGCTGAGGGTAGAGGG + Intergenic
1148287739 17:46410631-46410653 CCTGGGAGGCTGAGGTTGGGAGG + Intergenic
1148309908 17:46628211-46628233 CCTGGGAGGCTGAGGTTGGGAGG + Intronic
1148486814 17:47996123-47996145 CCTTGGGAGCAGATGGTGGGAGG - Intergenic
1148556559 17:48582099-48582121 CCTGGACGGCGGAGGGTGGCTGG - Intronic
1149079496 17:52637131-52637153 ACTTGAGGGCGGAGGGTGGGAGG + Intergenic
1149362119 17:55906355-55906377 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1149395219 17:56234497-56234519 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1149521056 17:57318581-57318603 GCTTGAAGGCAGAGGGTGCTGGG + Intronic
1149565509 17:57638181-57638203 CCTGGAGAGGAGAGGGTGGGGGG - Intronic
1149624595 17:58071590-58071612 ACTTGATGGAGGAGGGTGGGAGG + Intergenic
1149742044 17:59055769-59055791 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1150295518 17:64005408-64005430 ACTGGAGGGCAGGGGGTGGGGGG - Intronic
1150436386 17:65157477-65157499 CCTTGAGGGGAGCAGGTGGGTGG + Intronic
1150439646 17:65180795-65180817 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1150677099 17:67254108-67254130 CCTGGAAGGCAGAGGTTGCAGGG - Intergenic
1150846773 17:68666463-68666485 ACTTGAGGGGGGAGGGTGGGAGG - Intergenic
1150860440 17:68795727-68795749 TCTTAAGGGCAGTGGGTGGGGGG + Intergenic
1150998859 17:70350957-70350979 ACCTGAAGGTGGAGGGTGGGAGG + Intergenic
1151060709 17:71090568-71090590 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1151253589 17:72857129-72857151 GCTTGAGGGTGGAGGGTGGGAGG - Intronic
1151405723 17:73884917-73884939 ACTGGAAGGCAGAGGGTAAGGGG + Intergenic
1151517801 17:74607626-74607648 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1151541620 17:74767652-74767674 CCTTGAAAGAAGAAGGTGGATGG - Intronic
1151636131 17:75349593-75349615 CCCAGGAGGCAGAGGGTGCGGGG - Intronic
1151748770 17:76025302-76025324 CCTTGAAGGCAGGGGCTTGTTGG + Intronic
1151892453 17:76958669-76958691 CTCTGAAGGCAGAGGGTGGGTGG + Intergenic
1151986663 17:77548256-77548278 CCTTGCAGGCAGAGGCCTGGCGG - Intergenic
1152054413 17:78012336-78012358 CCTTGAGGGTGGAGGGTGGAAGG + Intronic
1152170107 17:78740286-78740308 CCTTTAAGGCAGAGGCTGTGGGG - Intronic
1152196768 17:78923251-78923273 CCAGGATGGCAGAGGGTGGAGGG - Intronic
1152350811 17:79783130-79783152 CCTTGAAAGCTGATGGTGGACGG + Intronic
1152395716 17:80031605-80031627 CCTTGGAGGCAGAGGCTTTGGGG - Intronic
1152482555 17:80564742-80564764 ACTTGAGGGTAGACGGTGGGAGG - Intronic
1152744920 17:82034110-82034132 CCCTGGAGGGGGAGGGTGGGGGG + Exonic
1152815742 17:82406717-82406739 CTTGGGAGGCAGAGGGTGGGAGG - Intronic
1152946974 17:83203190-83203212 CCCTGAAGGCCAGGGGTGGGTGG + Intergenic
1153064165 18:1026183-1026205 GCTTGAGGGTAGAGAGTGGGAGG + Intergenic
1153186014 18:2487266-2487288 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1153543456 18:6181659-6181681 ACTTGAAGGTGGAGGGTGGGAGG - Intronic
1153760381 18:8325310-8325332 ACCTGAGGGTAGAGGGTGGGAGG - Intronic
1153775198 18:8447065-8447087 ACCTGAGGGCGGAGGGTGGGAGG + Intergenic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1153860212 18:9195176-9195198 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1154402024 18:14048447-14048469 ACTTGAGAGGAGAGGGTGGGAGG - Intergenic
1155060081 18:22220604-22220626 CTTTGAGGGTGGAGGGTGGGAGG - Intergenic
1155576913 18:27258610-27258632 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1155959228 18:31979689-31979711 GCTTTAGGGCAGAGAGTGGGAGG - Intergenic
1156340576 18:36206633-36206655 ACTTGAGGGTAGAAGGTGGGGGG - Intronic
1156572576 18:38275014-38275036 ATTTGAAGGTGGAGGGTGGGAGG + Intergenic
1156609234 18:38707066-38707088 CCTTGCAGGAAAAGAGTGGGAGG - Intergenic
1156618740 18:38822354-38822376 ACTTGAAGGTGGAGGATGGGAGG + Intergenic
1156928487 18:42612250-42612272 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1157139717 18:45093687-45093709 ACTTGAGGGTAGAGGGTTGGAGG + Intergenic
1157144338 18:45146235-45146257 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1157170189 18:45396816-45396838 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1157295303 18:46437880-46437902 ACCTGTGGGCAGAGGGTGGGTGG + Intronic
1157368387 18:47087541-47087563 GCTTGAGGGTGGAGGGTGGGAGG + Intronic
1157378558 18:47189838-47189860 CTGTGAAGGCAGAGGGTTGAGGG + Intergenic
1157760265 18:50257957-50257979 CCTGGGAGGCAGAGGTTGCGGGG + Intronic
1157987785 18:52459345-52459367 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1158057021 18:53293618-53293640 ACTTGAAGGTATAGGGTGCGAGG - Intronic
1158091599 18:53721063-53721085 GATTGACTGCAGAGGGTGGGAGG - Intergenic
1158688763 18:59641442-59641464 GCTTGAGGGTGGAGGGTGGGAGG + Intronic
1158749158 18:60238906-60238928 ACTTGATGGCATAGGGTAGGAGG - Intergenic
1158922458 18:62208654-62208676 ACTTGAAGGTAGAGGGTGGAAGG - Intronic
1159301878 18:66583487-66583509 ACCTGAGGGCAGAGGGTGGGAGG - Intronic
1159501409 18:69275618-69275640 AGTTGAGGGCGGAGGGTGGGAGG - Intergenic
1159576678 18:70186864-70186886 ACTCGACGGCAGAGAGTGGGAGG + Intronic
1159951767 18:74489236-74489258 CCTTGAAGGTGGAGGGGAGGAGG + Intergenic
1160138885 18:76301004-76301026 GCTTGAGGGTAGAGGGTGGGAGG + Intergenic
1160507948 18:79437685-79437707 CCGTCAGGGCAGAGGGTGGAGGG - Intronic
1161108020 19:2454215-2454237 CCCGGGAGGCAGAGGGTGCGGGG + Intronic
1161288958 19:3482848-3482870 CCTTGAAGGCAATGGAGGGGCGG + Intergenic
1161333516 19:3699321-3699343 CTTTCAAGGCGGGGGGTGGGGGG + Intronic
1161474115 19:4474864-4474886 CCAAGGATGCAGAGGGTGGGGGG - Intronic
1161558964 19:4960309-4960331 TCTTGAAGGCAGATGGGGTGAGG + Intronic
1161571933 19:5035557-5035579 CCAAGGAGGCAGAGGGAGGGAGG - Intronic
1161621746 19:5301389-5301411 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
1161627588 19:5336251-5336273 CCTTAAAGGAAAAGGGGGGGGGG + Intronic
1163102703 19:15107678-15107700 CCTGGAAGGAAGGGGCTGGGAGG + Intronic
1163277406 19:16294031-16294053 CTTAGGAGGCTGAGGGTGGGAGG - Intergenic
1163559502 19:18010374-18010396 GCTTGCATGCAGAGGGTGGGTGG + Intronic
1163819377 19:19487397-19487419 CCTGCAAGGCAGGGGGAGGGAGG + Intronic
1164887821 19:31797951-31797973 CCTTCCAGGCACAGAGTGGGTGG + Intergenic
1165082074 19:33313144-33313166 ACTTGAAGGTGGGGGGTGGGAGG + Intergenic
1165232407 19:34395284-34395306 CTTGGGAGGCAGAGGCTGGGGGG + Intronic
1165332815 19:35150794-35150816 CCTTGAGGGCAATGGGCGGGAGG + Intronic
1165665866 19:37627461-37627483 ACTTGAAGACAGAGGGTGGGAGG - Intronic
1165777494 19:38413279-38413301 CATTGAAGGGGGAGGGTGGCTGG + Exonic
1165993093 19:39826987-39827009 CCTGGCAGGGAGGGGGTGGGAGG + Exonic
1166025523 19:40080670-40080692 ACTTGAGAGTAGAGGGTGGGAGG + Intronic
1166381790 19:42358605-42358627 CCTTGAAGGCAGAAAGAGCGGGG - Intronic
1166398639 19:42461541-42461563 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1166409126 19:42544714-42544736 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1166520654 19:43478046-43478068 CCTTGAAGGCACAGCGTAAGTGG + Exonic
1166941444 19:46368710-46368732 CCTAGAAGGGGGAGAGTGGGAGG - Intronic
1167163342 19:47781375-47781397 CCCTGAAGGCAGAGGTGAGGGGG + Exonic
1167303269 19:48692148-48692170 CCTGGGAGGCAGAGGCGGGGTGG - Intergenic
1167716950 19:51148333-51148355 ACTTGAAGGTGGAGGGTGGGAGG - Intronic
1167824652 19:51961225-51961247 TCCTGAAGGCAGAGAGTGTGGGG - Intergenic
1167918079 19:52758615-52758637 ACTTGAGGGTAGAGAGTGGGAGG + Intergenic
1167924062 19:52809472-52809494 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1167995683 19:53400143-53400165 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1168056703 19:53868511-53868533 CCTGAAAGGCCGAGGGAGGGGGG + Intronic
1168156909 19:54478895-54478917 CCTTGAAGCCCCAAGGTGGGTGG + Intergenic
1168208780 19:54873303-54873325 CCTTTAGGGTGGAGGGTGGGAGG + Intergenic
1168362662 19:55755434-55755456 ACTCGAGGGTAGAGGGTGGGAGG - Intergenic
1202688747 1_KI270712v1_random:71376-71398 CTTTGAGGGTGGAGGGTGGGAGG + Intergenic
925017356 2:541392-541414 ACTTGAAGGAGGAGGGTGGGAGG + Intergenic
925087895 2:1125421-1125443 CTTTGAAGGCAAAGGAAGGGAGG - Intronic
925164145 2:1705282-1705304 CCATGAAGGCTGGGGTTGGGAGG + Intronic
925173825 2:1768553-1768575 TCTTCAAGGCCCAGGGTGGGCGG + Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925302028 2:2823849-2823871 ACTTGACGGTGGAGGGTGGGAGG - Intergenic
925419361 2:3699174-3699196 AATTGAAGGTGGAGGGTGGGAGG - Intronic
925565725 2:5252183-5252205 ACTTGAGGGCGGAGGGTGGAAGG - Intergenic
925647453 2:6051150-6051172 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
926531306 2:14049665-14049687 CCTTGAGGGCAGAGGGTGGGAGG - Intergenic
926557235 2:14373287-14373309 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
926595244 2:14782952-14782974 CCTTGAGGGTGGAAGGTGGGAGG + Intergenic
926783015 2:16492760-16492782 ATTTGAAGGAGGAGGGTGGGAGG + Intergenic
926835460 2:17014356-17014378 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
926856379 2:17260663-17260685 CCTTGAGGGTAGAGGGTGAGAGG - Intergenic
926981869 2:18580933-18580955 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
927135951 2:20096682-20096704 AATGGAGGGCAGAGGGTGGGTGG - Intergenic
927165618 2:20317701-20317723 CCTTGAGGGTAGAGGGTGGGAGG - Intronic
927501843 2:23588390-23588412 CCTGGGAGGCTGAAGGTGGGTGG - Intronic
928181112 2:29069530-29069552 CCTTGAGGGTGGAAGGTGGGAGG + Intronic
928272001 2:29864914-29864936 CCTTCAGGGGAGAGGGTGGGAGG - Intronic
928669144 2:33582535-33582557 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
928886142 2:36150671-36150693 ACTTGAGGGTAGAGGATGGGAGG + Intergenic
928946003 2:36772457-36772479 CCTGGAAGGCGGAGGTTGTGGGG + Intronic
929109419 2:38393925-38393947 CCTGGGAGGCTGAGGGTGGGTGG + Intergenic
929412145 2:41708850-41708872 ACTTGAGGGTAGAGTGTGGGAGG - Intergenic
929557618 2:42935402-42935424 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
929789690 2:45013757-45013779 CCTGGAGGGCAGAGGGGTGGCGG - Intergenic
930147245 2:48019793-48019815 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
930233640 2:48868052-48868074 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
930284294 2:49408924-49408946 CCTTGGAAGCAGAGCCTGGGAGG - Intergenic
930425159 2:51203871-51203893 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
930450492 2:51530615-51530637 TCTTGAGGGTGGAGGGTGGGAGG - Intergenic
930462002 2:51693167-51693189 TCTTGAGGGTGGAGGGTGGGAGG + Intergenic
930502024 2:52233489-52233511 ACTTGAGGGCTGAGGGTGGGAGG + Intergenic
930676974 2:54213086-54213108 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
930991360 2:57659749-57659771 GCTTTGAGGGAGAGGGTGGGAGG - Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
931649361 2:64454363-64454385 CCTGGCAGGCAGAGCCTGGGAGG - Exonic
931901328 2:66791602-66791624 CTTTGAAGACAGAGGCTAGGTGG + Intergenic
931921677 2:67023793-67023815 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
932007732 2:67944352-67944374 ACTTGAAGGTGGAGGATGGGAGG + Intergenic
932166242 2:69510194-69510216 CCTTGAAGGTGGAGGGTGGGAGG - Intronic
932173240 2:69576490-69576512 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
932222579 2:70011101-70011123 CCTTGAGGGTGGAGGGTGGGGGG + Intergenic
932827162 2:74952033-74952055 GCTTGAGGGTGGAGGGTGGGAGG + Intergenic
932843997 2:75116178-75116200 CCTGGGAGGCAGAGGTTGAGAGG - Intronic
933182225 2:79240366-79240388 CCTTGAGGATAGAGGGTGGGAGG - Intronic
933285884 2:80384161-80384183 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
933355484 2:81205256-81205278 ACTTGAGGGGAAAGGGTGGGAGG - Intergenic
933593074 2:84254531-84254553 CCTTGAGGGTAGAGGGTGGGAGG - Intergenic
935142613 2:100366691-100366713 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
935221056 2:101013193-101013215 CTGTGACGGCAGAGGTTGGGAGG - Intronic
935349540 2:102141888-102141910 CCTTGCAGGGAGAGGAGGGGAGG - Intronic
935575895 2:104710155-104710177 CCTTAAGAGAAGAGGGTGGGTGG - Intergenic
936268278 2:111028078-111028100 CCCAGAAGGCTGAGGTTGGGAGG + Intronic
936345861 2:111674404-111674426 TTTGGAAGGCTGAGGGTGGGTGG + Intergenic
936857119 2:116972046-116972068 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
937397732 2:121553186-121553208 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
937441992 2:121923692-121923714 ACCAGAGGGCAGAGGGTGGGAGG - Intergenic
937503228 2:122506408-122506430 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
937643802 2:124243653-124243675 ACTTGAAGGGAGAGGTTGGGAGG + Intronic
937782962 2:125860335-125860357 ACTTGGGGGCAGAGAGTGGGAGG - Intergenic
938112617 2:128578972-128578994 CTCAGAAGGCAGAGGTTGGGCGG - Intergenic
938370773 2:130767125-130767147 CCATGAAGGGAGAAGGTGGCTGG + Exonic
938623407 2:133082031-133082053 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
938650241 2:133375588-133375610 ACCAGAGGGCAGAGGGTGGGAGG - Intronic
938751122 2:134331608-134331630 CGTTGACGGCAGGGGGTTGGTGG + Intronic
938867227 2:135435137-135435159 ACTCGAAGGGGGAGGGTGGGAGG - Intronic
939181269 2:138804815-138804837 ACTTGAAGGCAGTTGCTGGGAGG + Intergenic
939274499 2:139983692-139983714 ACTTGAGGGCAGAGGGTTGGGGG - Intergenic
939292029 2:140208158-140208180 ACTTGAAGGTGGAAGGTGGGAGG + Intergenic
939315495 2:140544468-140544490 ACTGGAGGGCAGAGGGTGAGAGG - Intronic
940149364 2:150582368-150582390 TCTTGGAGTCAGAGGGAGGGAGG - Intergenic
940309372 2:152261318-152261340 ACTTCAGGGGAGAGGGTGGGAGG + Intergenic
940539105 2:154988070-154988092 GCTTGAGGGTAGAGGGTAGGAGG + Intergenic
940584131 2:155622608-155622630 ACCTTAAGGCAGAGGGTGGACGG + Intergenic
940708492 2:157133328-157133350 ACTTGAGGGTTGAGGGTGGGAGG + Intergenic
940831685 2:158473648-158473670 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
941239960 2:163025001-163025023 ACTGGAGGGCAGAGGGTAGGAGG + Intergenic
941566001 2:167109016-167109038 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
941860934 2:170279611-170279633 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
941956773 2:171213308-171213330 CCTGGCAGGCTGAGGTTGGGAGG - Intronic
942159096 2:173163272-173163294 ACTTGAAGGTGGAGGGTGGGAGG - Intronic
942541275 2:177017771-177017793 CCCTGGGGACAGAGGGTGGGAGG + Intergenic
942746821 2:179243749-179243771 ACTAGAGGGGAGAGGGTGGGTGG + Intronic
942963993 2:181867155-181867177 CCTTGATGGGGGAGGGTGAGAGG + Intergenic
943030045 2:182675102-182675124 ACTTGAGGGTAGAGGGTGAGAGG - Intergenic
943053547 2:182946434-182946456 ACTTGAAGGTAGAGGGTGGGAGG + Intronic
943148940 2:184084870-184084892 ACTTGAAGATGGAGGGTGGGAGG + Intergenic
943304693 2:186245454-186245476 ACTTGAAGGTAGAGAGAGGGAGG + Intergenic
943307287 2:186279321-186279343 ACTTGAGGGCGGAGGTTGGGAGG - Intergenic
943312016 2:186337544-186337566 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
943323843 2:186474927-186474949 ACTTGACGGTAGAGGGTGGGAGG + Intergenic
943432653 2:187824162-187824184 TTCAGAAGGCAGAGGGTGGGAGG - Intergenic
943611472 2:190039667-190039689 ACTTGAGGGGAGAGGGTGGGAGG - Intronic
943698828 2:190967002-190967024 CATTAAAGGCAGAGACTGGGGGG + Intronic
943854246 2:192768156-192768178 CCCTGAAGGAAGAAGGTGGTAGG + Intergenic
944085855 2:195847487-195847509 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
944576366 2:201094876-201094898 ACTTGAAGGTGGAGGATGGGAGG + Intergenic
944604252 2:201336154-201336176 ACTTGAAGGTGGAGGTTGGGAGG - Intronic
944630614 2:201619998-201620020 ACTTGACGGCGAAGGGTGGGAGG + Intergenic
944943258 2:204653114-204653136 TCTTGAAGGTGGAGGTTGGGAGG + Intronic
945139825 2:206673077-206673099 ACTGGAGGGCAGAGGGTGGGAGG - Intronic
945594341 2:211773178-211773200 CCTTGGTAGCAGAGGCTGGGAGG + Intronic
945604114 2:211906699-211906721 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
945790862 2:214304004-214304026 ACTGGAAGGTGGAGGGTGGGAGG - Intronic
945798583 2:214395675-214395697 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
946038734 2:216765899-216765921 CACTGCAGGCTGAGGGTGGGAGG + Intergenic
946090013 2:217213507-217213529 CCTTGAGGACGGAGGGTGGAAGG + Intergenic
946103241 2:217345684-217345706 ACTGGAAGGTGGAGGGTGGGAGG - Intronic
946335889 2:219036197-219036219 CCCAGAAGGCAGGGGATGGGTGG - Intronic
946594142 2:221287559-221287581 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
946884848 2:224212826-224212848 CCCTGAGGGTAGAGGGTGGGAGG - Intergenic
947427838 2:229999855-229999877 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
947438444 2:230094256-230094278 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
947859468 2:233348479-233348501 CACAGAAGGCAGAGGGTGAGTGG + Intergenic
948043463 2:234923859-234923881 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
948118005 2:235507947-235507969 GCTTGAGGGTGGAGGGTGGGAGG - Intronic
948331278 2:237167946-237167968 ACTGGAGGGCGGAGGGTGGGAGG - Intergenic
948374376 2:237511854-237511876 CTTTTCAGGGAGAGGGTGGGAGG + Intronic
948533786 2:238631417-238631439 CATTGCAGGCACAGGGAGGGAGG + Intergenic
948907335 2:240986199-240986221 CCTTGGACCCACAGGGTGGGTGG - Intronic
949054622 2:241921066-241921088 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1168742627 20:206059-206081 CCTTGAGGGTGGAGGGCGGGAGG + Intergenic
1168845303 20:940390-940412 CAGCAAAGGCAGAGGGTGGGAGG + Intergenic
1169278022 20:4246551-4246573 CCGTGACGGCAGAGAGGGGGAGG + Intronic
1169945776 20:10986287-10986309 CCATGAAGGCAGTGGGGGTGGGG + Intergenic
1170143247 20:13146271-13146293 GCTTGAGGGAGGAGGGTGGGAGG + Intronic
1170247629 20:14240685-14240707 ACTTGAGGGCAGAAGGAGGGAGG + Intronic
1170511341 20:17080441-17080463 ACTTAAGGGCAAAGGGTGGGGGG + Intergenic
1170653231 20:18261876-18261898 ACTTGATGGGGGAGGGTGGGAGG + Intergenic
1171117904 20:22542473-22542495 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1171138547 20:22720530-22720552 CCTTGAGGGTGGAGGGTGGGAGG - Intergenic
1171228517 20:23461971-23461993 ATTGGAAGGCAGAGGGTAGGAGG - Intergenic
1171231088 20:23485908-23485930 ACTTGAGGATAGAGGGTGGGAGG - Intergenic
1171281561 20:23903700-23903722 ACTTGAAAGGGGAGGGTGGGAGG + Intergenic
1171937805 20:31292613-31292635 ACTTGAGGGCGGAGGGTGGGAGG + Intergenic
1172038832 20:32029634-32029656 CCTTTCAGGCAGGGGTTGGGTGG + Intronic
1172109872 20:32538490-32538512 CCATGAAGGAGGAGGGAGGGAGG - Intronic
1172173405 20:32958337-32958359 CCTTGAAGGGAGAGGATAAGGGG + Intronic
1172380102 20:34482633-34482655 CCATGAAAGCAGCCGGTGGGGGG - Intronic
1172402464 20:34661358-34661380 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1172597586 20:36160507-36160529 CCCGGAAGGCAGAGGTTGTGGGG + Intronic
1172612107 20:36260057-36260079 CCTGGCAGGCTGGGGGTGGGTGG - Intronic
1172700143 20:36848261-36848283 CCTTGTGGGCAGGGAGTGGGTGG - Intronic
1172761217 20:37323802-37323824 ACTTGAAGGGGGAGGGTGGGAGG + Intergenic
1172863539 20:38076998-38077020 GCTTGAAGTCAGGAGGTGGGAGG - Intronic
1172875120 20:38159353-38159375 CCTTGAGGGTGGAGGGTGAGAGG + Intronic
1172949579 20:38714258-38714280 CCTTGCAGGCTGAGGGTGGGGGG + Intergenic
1173137530 20:40452549-40452571 ACTTGAAGGTGGAGGGTGAGAGG - Intergenic
1173380485 20:42535318-42535340 ACTTGAGGGTAGAGGGAGGGAGG + Intronic
1173517648 20:43676266-43676288 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1173650332 20:44659703-44659725 GCTGGAAGGCAGATGGTGAGTGG - Intergenic
1173697564 20:45032418-45032440 CCTTGAGGGCAGAGGGTGGGAGG - Intronic
1173925560 20:46778705-46778727 CTTTGCAGGAAGAGGGAGGGAGG - Intergenic
1173960946 20:47072082-47072104 CCTTGAAGCCACATGGAGGGAGG + Intronic
1174132302 20:48354364-48354386 CCTGGAGCTCAGAGGGTGGGAGG + Intergenic
1174425795 20:50430843-50430865 CCTTGCTGGCAACGGGTGGGTGG - Intergenic
1174652489 20:52139496-52139518 ACTTGAAGATGGAGGGTGGGAGG + Intronic
1174680841 20:52406752-52406774 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
1174711414 20:52709590-52709612 ACTTGAAGGTGGAGAGTGGGAGG + Intergenic
1175114733 20:56674036-56674058 GCTCTCAGGCAGAGGGTGGGTGG + Intergenic
1175206084 20:57312388-57312410 TCATCAAGGCAGAGGATGGGAGG + Intergenic
1175672537 20:60917861-60917883 ACTTGAAGGCAGAGGGTAAGAGG + Intergenic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1176164110 20:63663933-63663955 CCTTGGAGGGACAGGGTGGGCGG + Intronic
1176191311 20:63811407-63811429 CCTGGAAGTCAGAAGCTGGGAGG - Intronic
1176317356 21:5259044-5259066 ATTTGAAGTAAGAGGGTGGGAGG - Intergenic
1176705615 21:10118532-10118554 CCATGAGGGCAGAGGGCGAGAGG + Intergenic
1176864770 21:14041004-14041026 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
1177493359 21:21856914-21856936 ACTTGAGGACAGAGAGTGGGAGG + Intergenic
1177571159 21:22888872-22888894 ACTTGAAAGTGGAGGGTGGGAGG - Intergenic
1177886416 21:26751227-26751249 ACTTGAGGGTAGAAGGTGGGAGG + Intergenic
1178060336 21:28846782-28846804 ACTTGAGGGTAGATGGTGGGAGG - Intergenic
1178301548 21:31457790-31457812 CCCTGGAGGCAGGAGGTGGGGGG - Intronic
1178358952 21:31932338-31932360 CCTTCAGGACAGAGGGTGCGAGG - Intronic
1178489516 21:33040227-33040249 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1178586751 21:33877127-33877149 CCTGGGAGGCAGAGGTTGCGGGG - Intronic
1178802489 21:35809100-35809122 ACTTGAAGGTGGAGGGTGGGAGG + Intronic
1179046810 21:37852101-37852123 CCTGGAAAGCAAAGGCTGGGTGG + Intronic
1179086219 21:38220192-38220214 ACTTGAGGGCACAGGGAGGGAGG + Intronic
1179149369 21:38796852-38796874 CCTGGAAGGGAGAGAGAGGGAGG - Intergenic
1179164142 21:38922490-38922512 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1179174506 21:38997951-38997973 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1179253260 21:39692112-39692134 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1179256093 21:39716493-39716515 GCTTGAGCGGAGAGGGTGGGAGG - Intergenic
1179370784 21:40804487-40804509 GCTAGCAGGCAGAGGGTGGTAGG - Intronic
1179725520 21:43339503-43339525 CCTTGTAGGCAGAGGCTGAGGGG - Intergenic
1180199480 21:46215866-46215888 CCCTGAGGGCGGATGGTGGGAGG - Intronic
1180552679 22:16553225-16553247 CTTTGAGGGTGGAGGGTGGGAGG - Intergenic
1180674025 22:17574761-17574783 TCTGGGAGGCCGAGGGTGGGTGG - Intronic
1180700723 22:17780253-17780275 TCTGGAGGGCAGAGGGTGCGTGG + Intergenic
1180979237 22:19871016-19871038 TCTGGGAGGCAGAGTGTGGGAGG - Intergenic
1181469178 22:23127486-23127508 CCTTGATGCCACAGGGTGAGGGG - Intronic
1181634717 22:24169245-24169267 CCTCCAAGCCAGAGGGTAGGTGG + Intronic
1181748367 22:24971760-24971782 GCTTGTAGGTAGAGGGTTGGGGG + Intronic
1181793642 22:25287042-25287064 CCTTGAAGGCAGGGGATGAGTGG + Intergenic
1181833640 22:25583586-25583608 CCTTGAAGGCAGGGGATGAGTGG + Intronic
1182067919 22:27443501-27443523 CCTTGAGGAGGGAGGGTGGGAGG - Intergenic
1182263126 22:29090376-29090398 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1182453261 22:30433595-30433617 CCTGGAAGGCACAGGTTGGAAGG - Intergenic
1183278846 22:36921623-36921645 ACTGGCAAGCAGAGGGTGGGGGG + Intronic
1183437476 22:37804271-37804293 CCTTGAAGGCAATGTGGGGGCGG - Intergenic
1183925868 22:41205473-41205495 CCTGGAGGGTGGAGGGTGGGAGG + Intronic
1184039565 22:41934973-41934995 CCTGGAAGGCGGGGGATGGGTGG - Intergenic
1184248346 22:43246848-43246870 CCACGAAGTCACAGGGTGGGAGG - Intronic
1184355972 22:43979913-43979935 TCTTAAAGGCAGGGAGTGGGAGG - Intronic
1184652446 22:45925408-45925430 CCAGGATGGCAGAGGGTGGGAGG + Intronic
1184727127 22:46353681-46353703 TCATGAAGGCAGATGCTGGGAGG - Intronic
1184947227 22:47812151-47812173 CCTTGAAGACAGAGATTGGAGGG + Intergenic
1185231045 22:49683023-49683045 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
949107641 3:219691-219713 ACTTGAAGGTGGAGGGTGGGAGG + Intronic
949270985 3:2216382-2216404 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
949375759 3:3388723-3388745 AGTTGAAGGTGGAGGGTGGGAGG - Intergenic
949376379 3:3394588-3394610 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
949509571 3:4756476-4756498 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
950016758 3:9759908-9759930 GCTGGAAGGCACGGGGTGGGAGG - Intronic
950106486 3:10392133-10392155 CCTTGAAGGCAGTGTCTGAGTGG + Intronic
950240485 3:11365683-11365705 CCTAGCTGGCAGAAGGTGGGTGG - Intronic
950309569 3:11944997-11945019 ACTTGAGAGTAGAGGGTGGGAGG - Intergenic
950407025 3:12811101-12811123 CCTTGCAGGCACACGGCGGGGGG + Intronic
950408097 3:12816990-12817012 CCTGCACGGCAGACGGTGGGAGG - Exonic
950909543 3:16574677-16574699 ACTTGATGGGGGAGGGTGGGAGG + Intergenic
950974641 3:17227693-17227715 ACTTGAATGTGGAGGGTGGGAGG + Intronic
951015351 3:17725861-17725883 ACTTGAGGGTTGAGGGTGGGAGG - Intronic
951394753 3:22152000-22152022 ACTTGAAGGTGGAGGGTGGAAGG - Intronic
951634905 3:24763183-24763205 CCTTGAAGGAAGAGGTTGTTGGG - Intergenic
951732814 3:25829373-25829395 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
951758964 3:26124192-26124214 ACTAGAAGGGGGAGGGTGGGAGG + Intergenic
952234011 3:31460547-31460569 CAGTGAAGGCAGAGGGTGTTGGG - Intergenic
952413499 3:33069953-33069975 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
952704238 3:36361096-36361118 ACTTTAGGGTAGAGGGTGGGAGG + Intergenic
953039861 3:39246342-39246364 ACTTGAGGGCCGAGGGTGGGAGG - Intergenic
953056100 3:39388344-39388366 TGTTGGAGGCAGGGGGTGGGGGG - Intronic
953079635 3:39603745-39603767 TCTTGAGGGTGGAGGGTGGGAGG - Intergenic
953225866 3:41019882-41019904 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
953230568 3:41061543-41061565 ACTTGAGGGTAGGGGGTGGGAGG - Intergenic
953290921 3:41661644-41661666 CCTGTGAGGCAGAGGGTGTGGGG + Intronic
953745142 3:45568370-45568392 GCTTGAGGGTGGAGGGTGGGAGG - Intronic
953818797 3:46185986-46186008 ACTTGAAGGTGGAGGGTGGGAGG - Intronic
954053183 3:47999691-47999713 CCTGGAGGGTGGAGGGTGGGAGG + Intronic
954131112 3:48561358-48561380 ACATGAAGGCAGACGCTGGGTGG - Intronic
954343065 3:49971188-49971210 CCTGGGAGGCAGAGGTTGCGGGG + Intronic
954447963 3:50556861-50556883 GCTAGAGGGCAGAAGGTGGGTGG + Intergenic
954657819 3:52207628-52207650 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
954939475 3:54358381-54358403 CCTTGCAGTCAGAGGGGAGGAGG - Intronic
954940906 3:54372313-54372335 CAGTGAAAGAAGAGGGTGGGTGG + Intronic
954960297 3:54558564-54558586 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
954985371 3:54786002-54786024 CCATGATGGCAGAGGGTGGCTGG - Intronic
955125676 3:56109174-56109196 ACCTGAAGGTAGAAGGTGGGAGG - Intronic
955149143 3:56349573-56349595 ACTTGAGGGTTGAGGGTGGGAGG + Intronic
955289194 3:57674970-57674992 ACTTGATGGTGGAGGGTGGGAGG + Intronic
955442136 3:58967856-58967878 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
955595570 3:60586838-60586860 GCTTGAGGGCAGAGGGTTGGAGG + Intronic
955960449 3:64335227-64335249 CCTTGAAAAAAAAGGGTGGGAGG + Intronic
956032270 3:65051406-65051428 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
956053338 3:65272456-65272478 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
956057270 3:65313228-65313250 ACTTGATGGTGGAGGGTGGGAGG - Intergenic
956236105 3:67072666-67072688 GCTTGATGGTGGAGGGTGGGAGG - Intergenic
956350763 3:68333471-68333493 ACTTGAGTGTAGAGGGTGGGTGG + Intronic
956354477 3:68376401-68376423 ACTTGAGGGTAGATGGTGGGAGG - Intronic
956447364 3:69338678-69338700 ACTTGAGGGTAGAGGGTAGGAGG + Intronic
956577452 3:70768962-70768984 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
956737577 3:72249716-72249738 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
957484482 3:80840559-80840581 ACTTGATGGAGGAGGGTGGGAGG + Intergenic
957746492 3:84349526-84349548 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
957901359 3:86497576-86497598 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
958014352 3:87920719-87920741 GCTTGAAGGTGGAGAGTGGGAGG + Intergenic
958021947 3:88008332-88008354 ACTTGAAGGTAGAGGGTGAGAGG - Intergenic
958463126 3:94424247-94424269 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
958843274 3:99234627-99234649 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
958851343 3:99329577-99329599 ACTTGAAGGTGGAGGGAGGGAGG + Intergenic
959050075 3:101516116-101516138 TCTTTAAAGAAGAGGGTGGGTGG - Intergenic
959111772 3:102131265-102131287 CCTTGAGGGTAAAGGGTGGGAGG + Intronic
959115210 3:102169401-102169423 ACTTGAAAGTGGAGGGTGGGAGG - Intronic
959128242 3:102317612-102317634 GCTTGAAAGTGGAGGGTGGGAGG - Intronic
959310798 3:104734394-104734416 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
959371583 3:105533680-105533702 CCTTGAAGGAGGTGGGTGTGAGG + Exonic
959451387 3:106507393-106507415 ACTTGAGGGCAGAGGGTGGGAGG - Intergenic
959481562 3:106878919-106878941 TATTGAAGGTAGAGAGTGGGAGG + Intergenic
959881921 3:111453674-111453696 ACTTTAGGGTAGAGGGTGGGAGG + Intronic
959960413 3:112292108-112292130 ACTTGAGGGTAGATGGTGGGAGG + Intronic
960098166 3:113708202-113708224 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
960342629 3:116493104-116493126 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
961096542 3:124161460-124161482 CCTTGAAGGCAGGGGTAGAGGGG - Intronic
961266093 3:125644111-125644133 CCAGGAAGCAAGAGGGTGGGTGG + Intergenic
961341908 3:126229857-126229879 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
961509436 3:127391965-127391987 GCTGGAGGGCAGAGGGCGGGCGG + Intergenic
961578309 3:127856702-127856724 ACTTGAAGGTGGAGGCTGGGAGG - Intergenic
961910639 3:130312730-130312752 ACTGGAAGGTGGAGGGTGGGAGG + Intergenic
962002488 3:131312971-131312993 ACTAGAAGGTGGAGGGTGGGAGG - Intronic
962076643 3:132088958-132088980 CCTTGAAGATAGTAGGTGGGTGG - Intronic
962123539 3:132589861-132589883 GCTTGAGGGTGGAGGGTGGGAGG - Intronic
962249509 3:133827097-133827119 CCTCCTAGGCAGAGGGTGTGTGG + Exonic
962832353 3:139155547-139155569 ACTTGAAGGTGGTGGGTGGGAGG + Intronic
962904348 3:139788706-139788728 TCTATAAGGCAGGGGGTGGGGGG + Intergenic
963035041 3:141018820-141018842 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
963204753 3:142621370-142621392 CCTTGAACACAGAGGGTAGATGG - Intronic
963509657 3:146231014-146231036 TCTGGAGGGCAGAAGGTGGGAGG - Intronic
963609319 3:147445134-147445156 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
963674405 3:148290953-148290975 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
963787008 3:149545167-149545189 ACTTGAAGGCCTGGGGTGGGAGG + Intronic
963831208 3:150011611-150011633 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
963963123 3:151332890-151332912 CATTGAGGGTAGTGGGTGGGAGG - Intronic
963993848 3:151684272-151684294 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
964158837 3:153621281-153621303 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
964366331 3:155954412-155954434 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
964375266 3:156043071-156043093 CCTTGAAGGTGGAGGGTGAAAGG - Intronic
964487057 3:157196931-157196953 ACTTGATGGGGGAGGGTGGGAGG + Intergenic
964687690 3:159415444-159415466 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
965036720 3:163449342-163449364 ACTTGAAAGTGGAGGGTGGGAGG + Intergenic
965065827 3:163847362-163847384 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
965230467 3:166045028-166045050 GCTTGAGGGTAGAAGGTGGGAGG - Intergenic
965318284 3:167218101-167218123 TCTTGAAGTGAGAGGGTGGGAGG + Intergenic
965511538 3:169573138-169573160 CTGTGAAAGCAGAGGGTGAGGGG - Intronic
965563228 3:170081720-170081742 ACTTGAGGGAGGAGGGTGGGAGG - Intronic
965877531 3:173345329-173345351 ACTTGAAGGTAAAGGTTGGGAGG + Intergenic
966042020 3:175503077-175503099 ACTTGAGGGTAGATGGTGGGTGG - Intronic
966061356 3:175760352-175760374 CCTTGAAAACAGAGGCTGTGAGG - Intronic
966267547 3:178064484-178064506 CCTGGGAGGCAGAGGTTGCGGGG - Intergenic
966516159 3:180822903-180822925 CCTTGAAGGCAGAGGGTGGGAGG + Intronic
966647784 3:182266097-182266119 ACTGGAGGGTAGAGGGTGGGAGG + Intergenic
967114252 3:186322421-186322443 ACTTGAAGGTGGAGGATGGGAGG + Intronic
967234938 3:187374881-187374903 CCCAGAGGGCAGAGGGTGGGAGG - Intergenic
967253227 3:187564340-187564362 GGTTGAAGGCATAGAGTGGGAGG + Intergenic
967416117 3:189220582-189220604 ACCTGAAGGTAGAAGGTGGGAGG - Intronic
967439150 3:189486793-189486815 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
967768633 3:193310016-193310038 ACTTGAGAGCAGAGGGTGGGAGG - Intronic
968019234 3:195369416-195369438 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
968123672 3:196143368-196143390 CTTTGAAGGGCGAGGATGGGCGG + Intergenic
968607315 4:1541654-1541676 CCCTGAAGGCAGGGGGAGGTGGG - Intergenic
968924545 4:3540151-3540173 GCTAGAAGGCGGGGGGTGGGGGG - Intergenic
969038215 4:4273220-4273242 CCTTAAAGACAGTGGGTGAGAGG + Intronic
969521044 4:7677928-7677950 TCCGGAAGGCAGTGGGTGGGTGG + Intronic
969905757 4:10394241-10394263 CCTTGAAGACAGAAGTTGGATGG + Intergenic
969926981 4:10594276-10594298 GATGGAAGGCAGAGGATGGGGGG - Intronic
969951987 4:10846533-10846555 ACTTGAAAGTGGAGGGTGGGAGG + Intergenic
970196204 4:13552599-13552621 ACTTGATGGTGGAGGGTGGGAGG + Intergenic
970261209 4:14227014-14227036 GTTAGAAGGCAGAGGGAGGGGGG - Intergenic
970298265 4:14654640-14654662 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
970321142 4:14876774-14876796 ACTGGAGGGCAGAGGGTAGGAGG + Intergenic
970477599 4:16439472-16439494 CCTTGAAGGAAGAGAGGGGCTGG - Intergenic
970624711 4:17863992-17864014 ACTTGAGGGCAGAGGGTGGGAGG + Intronic
970678648 4:18481997-18482019 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
970945302 4:21683971-21683993 GCTTGAGGGAGGAGGGTGGGAGG + Intronic
970996613 4:22274864-22274886 ACTTGAGGGGAAAGGGTGGGAGG + Intergenic
971434935 4:26610597-26610619 ACTTGATGGTAGAGGGTGGGAGG - Intronic
971461731 4:26906270-26906292 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
971542692 4:27840858-27840880 ACTTGAGGGGAGAGGGCGGGTGG - Intergenic
971602634 4:28614773-28614795 GCTTGAGGGTGGAGGGTGGGTGG - Intergenic
971644985 4:29188208-29188230 ACTTGAGGGCGGAGGGTTGGAGG + Intergenic
971829499 4:31672400-31672422 CCTTGAGGGTGGAGGGTGGGAGG - Intergenic
972125908 4:35765415-35765437 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
972151206 4:36093200-36093222 ATTGGAAGGCGGAGGGTGGGGGG + Intronic
972678151 4:41280093-41280115 CCTGGAAGGCGGAAGGTGGAAGG - Intergenic
972823248 4:42726702-42726724 CCCTGAAGGCAGAGGTTGCAGGG - Intergenic
973070662 4:45854555-45854577 CCTTGAAGGCAGCAGATGGTTGG + Intergenic
973149717 4:46872317-46872339 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
973566045 4:52188650-52188672 ACCTGAGGGCAGAGGGTGGGAGG - Intergenic
973677161 4:53276610-53276632 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
973681178 4:53321931-53321953 CCATGCAGGCAGGGTGTGGGAGG - Intronic
973702279 4:53549012-53549034 ACTTGAAGGTGGAGGGTAGGAGG + Intronic
973761041 4:54116078-54116100 ACCTGAGGGTAGAGGGTGGGAGG - Intronic
974159851 4:58124523-58124545 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
974198289 4:58605179-58605201 ACTTGAAGGTGGAAGGTGGGAGG - Intergenic
974461049 4:62188337-62188359 ACTTGAAGGTTGAAGGTGGGAGG + Intergenic
974528284 4:63074686-63074708 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
974539171 4:63211238-63211260 ACTTGAGGGAAAAGGGTGGGAGG + Intergenic
974765997 4:66347272-66347294 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
974941984 4:68480950-68480972 ACTTGAGGGTTGAGGGTGGGAGG - Intronic
975904273 4:79190817-79190839 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
975927596 4:79477232-79477254 TCCTGAAGGTGGAGGGTGGGAGG - Intergenic
976001817 4:80383176-80383198 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
976015836 4:80553147-80553169 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
976178755 4:82379879-82379901 CTTGGGAGGCTGAGGGTGGGAGG - Intergenic
976367940 4:84251097-84251119 GCTTGAGGGAAGAGGGTGGCAGG + Intergenic
976793374 4:88905551-88905573 CCTCGAGGGTGGAGGGTGGGAGG - Intronic
977329471 4:95619342-95619364 ACTTGAGGATAGAGGGTGGGAGG + Intergenic
977552383 4:98456200-98456222 ACTTGAGAGTAGAGGGTGGGAGG + Intergenic
977850394 4:101820620-101820642 GCTTGAAGGTGGAGGGTGGGAGG - Intronic
978252991 4:106655613-106655635 ACTTGAGAGTAGAGGGTGGGAGG + Intergenic
978287055 4:107091834-107091856 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
978352030 4:107830025-107830047 ACTTGAGGGCAGAGGGTGGGAGG - Intronic
978949484 4:114540446-114540468 CCTTGAGGGTGGAGGGTAGGAGG - Intergenic
979158228 4:117425423-117425445 CCTTGAGGGCAGAGAGTGAGAGG - Intergenic
979224550 4:118269427-118269449 ACCTGAGGGCGGAGGGTGGGAGG - Intergenic
979590596 4:122475255-122475277 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
979709946 4:123767678-123767700 ACTTGAGGGTAGAGGGTGTGAGG + Intergenic
979724312 4:123942379-123942401 CAGTGCTGGCAGAGGGTGGGAGG - Intergenic
979780327 4:124643931-124643953 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
980147950 4:129013136-129013158 ACTTGAAAGGAGAGGGTGGGAGG - Intronic
980302973 4:131017811-131017833 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
980540200 4:134183452-134183474 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
980555424 4:134397258-134397280 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
980878509 4:138686261-138686283 CCTGGAAGGCACAGGGAGGACGG + Intergenic
981079027 4:140619940-140619962 CCTTGAGGGTGGAGGGTGGGTGG - Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981495868 4:145391562-145391584 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
981627157 4:146771406-146771428 ACTGGAGGGCAGAGGGTGGTAGG - Intronic
981681699 4:147406893-147406915 CCCAGAAGGCAGAGGTTGCGGGG + Intergenic
982499623 4:156136851-156136873 ACTTGAAGATGGAGGGTGGGAGG + Intergenic
982683086 4:158456216-158456238 ACTTGAAGGGGGAAGGTGGGAGG + Intronic
982690521 4:158542953-158542975 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
982735421 4:159001500-159001522 ACTTGAGGGTAGAGGATGGGAGG - Intronic
982926786 4:161347959-161347981 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
983152999 4:164308798-164308820 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
983308065 4:166019299-166019321 ACTAGAGGGGAGAGGGTGGGAGG + Intronic
983361975 4:166737974-166737996 CGATGAAGGCAGATGGTGGCAGG - Intronic
983439226 4:167759821-167759843 CCTTGAAGGTGGAGATTGGGAGG + Intergenic
983447283 4:167869489-167869511 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
983486708 4:168340793-168340815 ACTTGAGTGTAGAGGGTGGGAGG - Intergenic
983548207 4:168985902-168985924 ACTTGAAAGTGGAGGGTGGGAGG + Intronic
983614204 4:169683817-169683839 CCTGGAAGGCAGAGGTTGCAGGG - Intronic
983683498 4:170380199-170380221 ACTTGAGGGTAGAGGGTGGAAGG - Intergenic
983728426 4:170961032-170961054 ACTGGAGGGTAGAGGGTGGGAGG + Intergenic
984516629 4:180749487-180749509 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
984531313 4:180920008-180920030 CCTTGAAGGCAGAGAATGTCTGG - Intergenic
984768573 4:183418783-183418805 TTTTGAAGGGTGAGGGTGGGAGG - Intergenic
984887368 4:184461978-184462000 CCTAGAAGGCAGACGGAGGCTGG - Intronic
985069010 4:186150242-186150264 CCTTGGAGGGAGGGGGAGGGAGG - Intronic
985239178 4:187911842-187911864 CCTTGAGGGTGGAGGTTGGGAGG - Intergenic
985469119 5:26884-26906 ACTTGAGGGGGGAGGGTGGGAGG - Intergenic
985641647 5:1066110-1066132 CCTGAAGGTCAGAGGGTGGGAGG - Intronic
985654999 5:1126633-1126655 ACTTGAGGGCAGAGAGTGGGAGG - Intergenic
985926696 5:3024827-3024849 CCTTGAAGGGAGAGGACGGCTGG - Intergenic
985942752 5:3151609-3151631 ACCAGAAGGTAGAGGGTGGGAGG + Intergenic
986268325 5:6209830-6209852 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
986381024 5:7185834-7185856 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
986910956 5:12556363-12556385 CCTGGGAGGCAGAGGTTGTGGGG - Intergenic
987072271 5:14349872-14349894 ACTTGAAGGTGGAGGCTGGGAGG - Intronic
987394520 5:17409691-17409713 GCTTGAGGGTGGAGGGTGGGAGG - Intergenic
987430495 5:17826739-17826761 ACTTGAAGGTTGAGGGTGGGAGG + Intergenic
987730885 5:21771055-21771077 ACTTGAGGACAGAGAGTGGGAGG + Intronic
987756725 5:22106124-22106146 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
987915384 5:24205907-24205929 ACCAGAAGGCAGAGGGTGAGAGG + Intergenic
988004065 5:25385070-25385092 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
988021059 5:25622698-25622720 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
988043793 5:25921513-25921535 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
988201867 5:28078247-28078269 ACTTGAGGGCAGAGGATGGGAGG - Intergenic
988890469 5:35610871-35610893 CCTTGGAGGCAGAGGTTGCAGGG + Intergenic
988974492 5:36501520-36501542 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
989126940 5:38063901-38063923 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
989266970 5:39486304-39486326 CTTTGAAGGCAGAGGGAGCTAGG - Intergenic
989298899 5:39864846-39864868 GCTTGAGGGTTGAGGGTGGGAGG - Intergenic
989593599 5:43135072-43135094 CCTGGGAGGCGGAGGTTGGGGGG - Intronic
989824862 5:45840774-45840796 ACTTGAAGGTAGAGAGTGGGAGG - Intergenic
990175780 5:53106544-53106566 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
990335879 5:54772454-54772476 CTTTGAAGGTAGAGGGATGGGGG + Intergenic
990425618 5:55685777-55685799 ACTGGAAGGTGGAGGGTGGGAGG - Intronic
990486669 5:56266030-56266052 ACTAGATGGGAGAGGGTGGGAGG - Intergenic
990923099 5:60989742-60989764 ACTTGAGGTCAGAGGGTGGGAGG + Intronic
991134113 5:63161140-63161162 TCTTGAAAGCGGAGGATGGGAGG + Intergenic
991455637 5:66800538-66800560 GCTTGAGGGTGGAGGGTGGGAGG + Intronic
991504895 5:67314555-67314577 ACTTAAAGGTAGAGGATGGGAGG + Intergenic
992249006 5:74858578-74858600 ACTTGAAGGTAGAGGGTGGGAGG + Intronic
992313871 5:75532234-75532256 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
992432147 5:76719511-76719533 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
992593322 5:78318692-78318714 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
992610578 5:78504898-78504920 CCATGCAGGCAGAGGGCTGGAGG + Intronic
992857991 5:80883601-80883623 CCTTGAGGGTGGAGGGTGGGAGG - Intergenic
992921373 5:81525328-81525350 CCTTGAGGATGGAGGGTGGGAGG - Intronic
993062413 5:83054679-83054701 ACTTGAGGGTGGAGGGTGGGAGG + Exonic
993238740 5:85351318-85351340 ACTTGAAGGGAAAGGCTGGGAGG - Intergenic
993275898 5:85858219-85858241 ACCTGAGGGTAGAGGGTGGGAGG + Intergenic
993633862 5:90320353-90320375 CTTTGAGGGCAGAGGGTGGAAGG - Intergenic
993801420 5:92347619-92347641 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
994010617 5:94897825-94897847 CCTTGAGGGCAGAGTTTGGGAGG - Intronic
994070441 5:95595663-95595685 ACTAGAAGGGAGAGGGAGGGAGG + Intronic
994228409 5:97282766-97282788 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
994242993 5:97446111-97446133 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
994469122 5:100179825-100179847 CCTTGAAAGAAGAGGGTTGGAGG + Intergenic
994645699 5:102466174-102466196 ACTGGAGGGCAGAGGGTGGGGGG - Intronic
994796539 5:104307841-104307863 CCTTCAGGGCAGAGGCTTGGCGG - Intergenic
994864644 5:105251366-105251388 ACTTGAGGGCCAAGGGTGGGAGG + Intergenic
995013015 5:107278743-107278765 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
995170622 5:109107478-109107500 ACTTGAGGGTAGAGGGTGGAGGG - Intronic
995269975 5:110208897-110208919 CCTTGAAGGGGGAGGATGGGAGG - Intergenic
995559717 5:113367613-113367635 TAAGGAAGGCAGAGGGTGGGGGG + Intronic
995653369 5:114396870-114396892 ACCTGAGGGTAGAGGGTGGGAGG - Intronic
995717974 5:115099168-115099190 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
996248172 5:121291931-121291953 CCTTGCAGGCAGCTGGTGGGAGG + Intergenic
996476059 5:123922124-123922146 GCCTGAAGATAGAGGGTGGGAGG - Intergenic
996588749 5:125121492-125121514 ACTTGAGGGTAGAGGTTGGGAGG - Intergenic
996614371 5:125422734-125422756 CATGGAAGGCAGAGGGAGGTGGG - Intergenic
996790638 5:127290224-127290246 AGGTGAAGGCAGAGGGTGGAGGG - Intergenic
996800418 5:127396813-127396835 GCATGAATGGAGAGGGTGGGTGG - Intronic
996835210 5:127784044-127784066 TCTTGAAGGCAGAAGATGGTTGG + Intergenic
996991512 5:129637961-129637983 ACTTGAATGGGGAGGGTGGGAGG + Intronic
997099729 5:130955914-130955936 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
997609462 5:135204804-135204826 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
997740623 5:136250166-136250188 CCAAAATGGCAGAGGGTGGGTGG + Intronic
997979848 5:138462202-138462224 TCTTGGAGGCTGAGGATGGGTGG + Intergenic
998017558 5:138744642-138744664 ACTTGAGAGCGGAGGGTGGGAGG - Intronic
998033668 5:138894713-138894735 CCTAGAAGCCACAGGATGGGTGG - Intronic
998401934 5:141852792-141852814 CCTTGATCTCAGGGGGTGGGAGG - Intergenic
998578086 5:143339707-143339729 CCTTCTAGGCTGAGGGTTGGTGG + Intronic
998594833 5:143517832-143517854 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
998761405 5:145436083-145436105 ACTTGAAGGTGGAGGTTGGGAGG - Intergenic
999071060 5:148744594-148744616 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
999194197 5:149771066-149771088 CCTTGAAGGAATTGGGTGGCTGG + Intronic
999807382 5:155095235-155095257 ACTTGAAGGCGGAGGGTGGAAGG + Intergenic
1000110409 5:158102938-158102960 CCTTAAGGGTGGAGGGTGGGAGG - Intergenic
1000276496 5:159740823-159740845 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1000547310 5:162619341-162619363 ACTTGGAGGTAGAGGGTGGTAGG - Intergenic
1000589438 5:163140926-163140948 ACTTGAGGGCGGAAGGTGGGAGG + Intergenic
1000642553 5:163719811-163719833 ACTTGGAGGTGGAGGGTGGGAGG + Intergenic
1000678444 5:164152926-164152948 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1000992551 5:167925949-167925971 ACTTGAGGGAATAGGGTGGGAGG + Intronic
1001012630 5:168112370-168112392 TCTGGAGGGTAGAGGGTGGGAGG - Intronic
1001206276 5:169766217-169766239 GCTTGAGGGTAGAGGGTGGGAGG - Intronic
1001485165 5:172114862-172114884 CAGTGAAGGCCGAAGGTGGGGGG - Intronic
1001503480 5:172257135-172257157 CCTTGAGGGCAGAGGATGGGAGG - Intronic
1001550407 5:172598432-172598454 GCCAGAAGACAGAGGGTGGGGGG + Intergenic
1001849036 5:174947099-174947121 CCTTGAGGGTGAAGGGTGGGAGG + Intergenic
1001858924 5:175036321-175036343 CCTTGAAGCCACAAGGTGGCAGG + Intergenic
1002096319 5:176833299-176833321 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1002821207 6:726669-726691 ACTTGAGGGTAGAGGGTGAGAGG + Intergenic
1002822961 6:745432-745454 ACTTGAGGGTAAAGGGTGGGAGG + Intergenic
1003114926 6:3277357-3277379 CCTGGAAGGGTGAGGGTGGGCGG - Intronic
1003814398 6:9821738-9821760 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1004034076 6:11904926-11904948 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1004059371 6:12177159-12177181 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1004122972 6:12843396-12843418 GCTTGAAGGCTGGGGGTGGCAGG + Intronic
1005102073 6:22182094-22182116 ACTTGAGGGTAGAGGGTGGAAGG - Intergenic
1005244913 6:23872644-23872666 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
1005283241 6:24297305-24297327 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1005622074 6:27629312-27629334 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
1005775170 6:29123467-29123489 ACTTGACGGTGGAGGGTGGGAGG + Intergenic
1005781232 6:29194703-29194725 ACTTGACGGTGGAGGGTGGGAGG + Intergenic
1005811566 6:29519881-29519903 CCTGCAAGGCAGAGGGAGAGAGG - Intergenic
1005922081 6:30411200-30411222 ACTTGAAGGCAACGGGTGGAAGG + Intergenic
1005923152 6:30418280-30418302 CCTGGAGTGCAGAGGGTGGGTGG + Intergenic
1006044371 6:31281806-31281828 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1006053426 6:31361628-31361650 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1006073609 6:31515316-31515338 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
1006344446 6:33468668-33468690 ACTTGAATGTGGAGGGTGGGAGG + Intergenic
1006503792 6:34475174-34475196 CCATGAAGGCAGGGTTTGGGTGG + Intronic
1006510966 6:34520828-34520850 GCTTGGAGACAGAGGGCGGGTGG + Intronic
1006514136 6:34536696-34536718 CCTTGTAGGAGGAGGGTGGGGGG - Intergenic
1006667618 6:35707701-35707723 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1006860425 6:37168961-37168983 CAAGGGAGGCAGAGGGTGGGGGG + Intergenic
1006915849 6:37593433-37593455 CCGTGCAGGCTGAGGGTGTGTGG + Intergenic
1006947222 6:37792752-37792774 TTTTGGAGGCAGAGGGTGGTGGG + Intergenic
1007139361 6:39555397-39555419 CCGTAAGGCCAGAGGGTGGGGGG - Intronic
1007216248 6:40241526-40241548 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1008119786 6:47598743-47598765 ACTTGAGGGGAAAGGGTGGGAGG + Intronic
1008265007 6:49414275-49414297 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1008526150 6:52408977-52408999 CCTTCAAGGAAGAGGATGTGTGG + Intergenic
1008736669 6:54552952-54552974 ACTTGAGGGTGGAGGGTGGGTGG + Intergenic
1008779532 6:55086218-55086240 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1008987091 6:57557613-57557635 CCTTGAGGGTGGAGGGTGGGAGG + Intronic
1009029373 6:58038196-58038218 CCAAGAAGGCAGAGGAGGGGTGG - Intergenic
1009175049 6:60450180-60450202 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
1009283222 6:61777998-61778020 ATTTGAAGGTAGAGGGTGGGAGG - Intronic
1009285267 6:61807662-61807684 CCTTGAAGGTTGAGGGTGGGAGG + Intronic
1009468659 6:64004604-64004626 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1009505164 6:64468650-64468672 ACTTGAAGGTGGAGGGTGGGAGG - Intronic
1009509108 6:64525517-64525539 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1009547392 6:65037304-65037326 ACTTGAAGGTCAAGGGTGGGAGG + Intronic
1009599335 6:65778028-65778050 ACTTGAGAGCTGAGGGTGGGAGG + Intergenic
1009656478 6:66552568-66552590 CCATGAGGGTGGAGGGTGGGAGG + Intergenic
1009753629 6:67905125-67905147 ACTTGAGGGGGGAGGGTGGGAGG + Intergenic
1009843570 6:69107886-69107908 ACTAGAAGGGAGAGGGAGGGAGG + Intronic
1009893321 6:69715769-69715791 ACTGGAGGGCAGAGGGTGGAAGG - Intronic
1010273738 6:73945179-73945201 CATGGAGGACAGAGGGTGGGAGG - Intergenic
1010839568 6:80632751-80632773 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1011281454 6:85681921-85681943 CCTTGAGGGTGGAGGGTTGGAGG - Intergenic
1012577150 6:100816748-100816770 ACCTGAGGGTAGAGGGTGGGAGG + Intronic
1012591042 6:100981606-100981628 ACTTGAAGAGGGAGGGTGGGAGG - Intergenic
1012939754 6:105403497-105403519 CCTTGGAAGCAGAGGGCTGGAGG + Intergenic
1013253878 6:108363369-108363391 ACTTGAGTGTAGAGGGTGGGAGG - Intronic
1013314790 6:108931069-108931091 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1013376897 6:109526128-109526150 ACTTGAGGGTAGAGGGTAGGAGG + Intronic
1013766581 6:113581016-113581038 CCTTGAGGGTTGAGGGTGGCAGG + Intergenic
1013864456 6:114678480-114678502 ACTTGATGGGGGAGGGTGGGAGG + Intergenic
1014124894 6:117765539-117765561 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1014335379 6:120127214-120127236 TCTTGAGGGTAGAGGCTGGGAGG - Intergenic
1014544261 6:122714671-122714693 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1014633342 6:123814138-123814160 CCTACAAGGCAGGGGGTGGAGGG + Intronic
1014717284 6:124880562-124880584 ACTTGAAGGTAGAGGATGGGAGG + Intergenic
1014961204 6:127687471-127687493 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1015288845 6:131515009-131515031 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
1015567674 6:134590428-134590450 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1015646781 6:135400044-135400066 ACTTGAGGGCAAAGGGTGGGAGG - Intronic
1015658257 6:135544314-135544336 ACTTGAAGGGGGAGGGTAGGAGG + Intergenic
1015686370 6:135867578-135867600 ACTGGACGGTAGAGGGTGGGAGG - Intronic
1016058505 6:139603701-139603723 TCTGGGAGGCAGAGAGTGGGTGG + Intergenic
1016084689 6:139898720-139898742 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1016238090 6:141892179-141892201 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1016287929 6:142493963-142493985 CCCTGAGGGAGGAGGGTGGGAGG + Intergenic
1016330145 6:142946102-142946124 CCTTAAGGACAGAGGGAGGGCGG + Intergenic
1016445630 6:144129267-144129289 ACTTGAAGGAGGAGGGTGGAAGG + Intergenic
1016546736 6:145232486-145232508 ACTTGAGGGCAGAGGGTGGGAGG - Intergenic
1016704862 6:147094961-147094983 ACTTGAAGGTGGAGGGTGAGAGG + Intergenic
1016777933 6:147925829-147925851 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1017026729 6:150187448-150187470 CCTTAAGGGTAGAGGGTGGGAGG - Intronic
1017056809 6:150443924-150443946 ACATGAAGCCAGAGAGTGGGAGG - Intergenic
1017261148 6:152389350-152389372 CCTTGAGGGTGGAAGGTGGGAGG - Intronic
1017492124 6:154953891-154953913 ACTTGGAGGCTGAGGGTGGGAGG + Intronic
1017929856 6:158942360-158942382 ACTTGAGGGTAGAAGGTGGGAGG - Intergenic
1017993999 6:159515362-159515384 CCTTGAGGGTGGAGGGTGGGAGG - Intergenic
1018001448 6:159582014-159582036 ACCTGAGGGTAGAGGGTGGGAGG + Intergenic
1018292760 6:162309858-162309880 TCTGGAAGGCAGAGGATGAGAGG - Intronic
1018389380 6:163330849-163330871 ACTTTAGGGCGGAGGGTGGGAGG - Intergenic
1018520052 6:164639121-164639143 CCTTGAGGGCAGAGGGTAGGAGG - Intergenic
1018550590 6:164992967-164992989 CCTGGGAGGCAGAGGTTGTGGGG + Intergenic
1018638189 6:165883457-165883479 GCTTGAACCCAGATGGTGGGAGG + Intronic
1018771534 6:166975303-166975325 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
1018811962 6:167304941-167304963 CCTTGAGGGGAGAAGGTGGCAGG - Intronic
1019099322 6:169615372-169615394 GCTTGAGGGTGGAGGGTGGGAGG - Intronic
1019183053 6:170204364-170204386 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1019183212 6:170205543-170205565 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
1019521923 7:1464761-1464783 CCTTGAAGGTGGGGGGGGGGGGG - Intergenic
1019647603 7:2139402-2139424 CCTTCACTGCTGAGGGTGGGGGG - Intronic
1019817176 7:3209887-3209909 CCTTGAGGGTGGAGAGTGGGAGG - Intergenic
1020035093 7:4959488-4959510 CCTGGAAGCCAGGAGGTGGGGGG + Intergenic
1020331491 7:7021852-7021874 ACTTGAAGGGGCAGGGTGGGAGG - Intergenic
1020651001 7:10876119-10876141 ACTTGAGGGTAGAGGGTGGAGGG - Intergenic
1020861371 7:13495998-13496020 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1020920453 7:14257501-14257523 CCTGGGAGGCACATGGTGGGAGG + Intronic
1020958262 7:14770747-14770769 CCTTGAAGGCATATTGTGGCAGG + Intronic
1020985939 7:15134448-15134470 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1021500257 7:21324823-21324845 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1021572493 7:22080613-22080635 ACTTGAGGGAAGAGGGTGGGAGG + Intergenic
1021608123 7:22429989-22430011 CCTTGAGGGCAGAGGGCATGAGG + Intronic
1021611966 7:22466369-22466391 ACTTGAGGGTGGAGGGTGGGGGG - Intronic
1021618485 7:22527099-22527121 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1021751341 7:23803731-23803753 ACTTAAGGGCAGAGGGTAGGAGG - Intronic
1021787781 7:24169635-24169657 ACTTGAGGGCAGAGGGTGAGAGG + Intergenic
1021834765 7:24658998-24659020 ACTTGAAGGCAGAGGATAAGAGG - Intronic
1022278149 7:28876550-28876572 GCTTGAAGCCAGGGGGTGGACGG + Intergenic
1022314812 7:29235879-29235901 GCTTGAAGGTGGAGGGTGGGAGG + Intronic
1022689841 7:32637965-32637987 TCCTGAAGGCACAGAGTGGGAGG - Intergenic
1022694900 7:32695034-32695056 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1022895127 7:34742314-34742336 ACTTGAAAGTGGAGGGTGGGAGG - Intronic
1022917421 7:34972198-34972220 TCCTGAAGGCACAGAGTGGGAGG - Intronic
1023282315 7:38583781-38583803 CCCTGGAGGCAGAGTGAGGGGGG + Intronic
1023406360 7:39837327-39837349 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1023505448 7:40895306-40895328 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1023571329 7:41575594-41575616 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1023616296 7:42023607-42023629 TCCTGAAAGAAGAGGGTGGGGGG + Exonic
1023870065 7:44258579-44258601 CACTGGAGGCAGCGGGTGGGTGG - Intronic
1024423323 7:49196203-49196225 ACTTGAGGGTAGAGAGTGGGAGG - Intergenic
1024627535 7:51220785-51220807 ACTTGAGGGCGGAAGGTGGGAGG - Intronic
1024733753 7:52280751-52280773 ACTTGAGGGTTGAGGGTGGGAGG - Intergenic
1025061123 7:55809256-55809278 CCTTGAGGGTGGAGGGTGGGAGG + Intronic
1025260506 7:57414781-57414803 CCTTCAAGGTAGAGGGCTGGTGG + Intergenic
1026209589 7:68292091-68292113 CCTTGAGGGTAGCAGGTGGGAGG + Intergenic
1026231480 7:68487912-68487934 GGTTGAAGGTGGAGGGTGGGAGG + Intergenic
1026343778 7:69456416-69456438 ACTTGAAGGTGGAGGATGGGAGG - Intergenic
1026403909 7:70044418-70044440 CAAAAAAGGCAGAGGGTGGGGGG - Intronic
1026576228 7:71573823-71573845 ACTTGAGGGCAGAGGGTGGGAGG - Intronic
1026636874 7:72091083-72091105 TTTGGGAGGCAGAGGGTGGGCGG + Intronic
1026829213 7:73600910-73600932 CCCGGAAGGGAGCGGGTGGGCGG - Intronic
1026866889 7:73829619-73829641 CCTGGAAGATAGAGGGAGGGTGG - Exonic
1026901424 7:74039518-74039540 CCTTGGTGACAGAGGGTGGGTGG + Intronic
1027231767 7:76276803-76276825 CCAAGATGGCAGAGGATGGGAGG - Intronic
1027429681 7:78097658-78097680 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1027481610 7:78704998-78705020 ACTTGAGGGTAGAGGGTGAGCGG + Intronic
1027847494 7:83400537-83400559 GCTTGAAGTCAGAGGGTGGGAGG - Intronic
1027883647 7:83874686-83874708 CCTTGAGGGAAGGGGGTTGGGGG - Intergenic
1028029491 7:85892159-85892181 CCTGGGAGGCTGAGGTTGGGAGG + Intergenic
1028608542 7:92682283-92682305 CAATGAAGGCAGAGAGTGGGTGG - Intronic
1028757968 7:94459788-94459810 ACTTGAGGGTGGAGGGTGGGTGG - Intergenic
1028881959 7:95890423-95890445 CCTTGACGGTGGAGGGTGAGAGG + Intronic
1028947388 7:96595973-96595995 CTTTGCAGGCATAGGGTGGAGGG + Intronic
1028998805 7:97130631-97130653 CTGTGATGGCAGAGGGTGGGAGG + Intronic
1029054425 7:97726357-97726379 GCTTGAGGGGGGAGGGTGGGAGG - Intergenic
1029545804 7:101210051-101210073 CCATGAGGGCAGGGGGTGGGTGG + Intronic
1030050510 7:105532904-105532926 CCTGGAAGGCTGAGTTTGGGCGG - Intronic
1030168861 7:106581670-106581692 ACTTGAAGATGGAGGGTGGGAGG + Intergenic
1030349220 7:108464483-108464505 ACTTGATGGGGGAGGGTGGGAGG + Intergenic
1030711155 7:112750938-112750960 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
1030718950 7:112846359-112846381 ACTTGAGGGTAGAGGATGGGAGG + Intronic
1030982770 7:116206269-116206291 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
1031059262 7:117031182-117031204 ACTTGAAGGAGGAGGGTGGGAGG + Intronic
1031738342 7:125395993-125396015 ATTGGAAGGCAGAGGGTGGGAGG + Intergenic
1031911645 7:127523055-127523077 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1032371935 7:131364624-131364646 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1032386933 7:131531654-131531676 CCATGAGGGCAGAGGTTGGCGGG - Intronic
1032586988 7:133156018-133156040 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1032625004 7:133582122-133582144 ACTTGAGGGTAGAGGGAGGGAGG - Intronic
1032960941 7:137033339-137033361 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1033273624 7:139955245-139955267 CAGTGACGGCAGAGGGTGGGAGG - Intronic
1033769045 7:144527931-144527953 ACTTGAGGGCAGAGGGTGGGAGG + Intronic
1033938971 7:146627233-146627255 CGTGGAAGGAAGATGGTGGGAGG - Intronic
1034045264 7:147920681-147920703 CCTTGGAAACACAGGGTGGGTGG + Intronic
1034173722 7:149083685-149083707 ACTTGAAGGTGGAGGCTGGGAGG - Intronic
1034313956 7:150112634-150112656 CCTTGATGGAGGAGGGAGGGAGG - Intergenic
1034540083 7:151752398-151752420 CTTAAGAGGCAGAGGGTGGGAGG + Intronic
1034683001 7:152945225-152945247 TCTTGAAGGCAGTGGATGGTTGG + Intergenic
1034792940 7:153988158-153988180 CCTTGACGGAGGAGGGAGGGAGG + Intronic
1035195472 7:157216501-157216523 ACTTGAAGGGGGAGGGTGGGAGG - Intronic
1035348246 7:158222568-158222590 TATGAAAGGCAGAGGGTGGGAGG + Intronic
1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG + Intronic
1035549982 8:514827-514849 CCTTGGAGGACCAGGGTGGGAGG - Intronic
1035963222 8:4159931-4159953 CCTTGAGGGGAAAGGGTGGGAGG + Intronic
1036055054 8:5242638-5242660 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1036430785 8:8688447-8688469 TCTTGACAGCTGAGGGTGGGAGG - Intergenic
1036490057 8:9216677-9216699 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1037061498 8:14516294-14516316 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
1037300937 8:17451361-17451383 TCTTGAGGGTGGAGGGTGGGAGG - Intergenic
1037400694 8:18492568-18492590 GCTTGAGGGTGGAGGGTGGGAGG - Intergenic
1037404053 8:18522818-18522840 GCTTGAGGGTGGAGGGTGGGAGG - Intergenic
1037475849 8:19256939-19256961 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
1037877168 8:22553954-22553976 CCTGGAGGGCAGTGGGCGGGTGG + Intronic
1037946316 8:22991705-22991727 CCAAGAAGGCAGAGGGTAAGGGG + Intronic
1038083437 8:24166048-24166070 TCCTGAAGGTGGAGGGTGGGAGG + Intergenic
1038116774 8:24564760-24564782 ACTTGAGGGTAGAGGGTGGAAGG + Intergenic
1038250847 8:25902962-25902984 CCTGGTAGGCAGAGGCTGAGTGG + Intronic
1038270655 8:26072621-26072643 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1038633681 8:29268613-29268635 CCTGGGAGGCAGAGGTTGCGCGG - Intergenic
1038817565 8:30920799-30920821 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1038854339 8:31314695-31314717 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1038949712 8:32401137-32401159 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1039168793 8:34717047-34717069 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
1039200905 8:35092554-35092576 CCTGGAGGGCAGAGAGTGGCAGG + Intergenic
1039245747 8:35606571-35606593 ACTCGAGGGGAGAGGGTGGGAGG - Intronic
1039443853 8:37614575-37614597 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1039473412 8:37827225-37827247 CCTAGAAGGCAGAGTGGGTGGGG - Intronic
1039631343 8:39114866-39114888 ACTTGAAGGTGGAGGATGGGAGG - Intronic
1039777658 8:40752539-40752561 CCATGACTGCAGAGAGTGGGAGG - Intronic
1039964129 8:42271514-42271536 CCTTGCAGGCAGCGGGGCGGCGG - Intronic
1040449912 8:47534624-47534646 ACTTGAAGAGGGAGGGTGGGAGG + Intronic
1040468454 8:47716692-47716714 CACTGACTGCAGAGGGTGGGTGG + Intronic
1040966659 8:53088708-53088730 ACTGGAAGGTGGAGGGTGGGAGG - Intergenic
1041013490 8:53567913-53567935 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1041140841 8:54817496-54817518 TCTAGAAGGCAGAGAGTGGTAGG + Intergenic
1041246893 8:55896812-55896834 CCCGGAAGGCAGAGGTTGCGGGG - Intronic
1041357000 8:57012039-57012061 CCTTAAGGGTGGAGGGTGGGAGG - Intergenic
1041611884 8:59860027-59860049 ACTTGAGGGGAGAGGTTGGGAGG + Intergenic
1041665143 8:60436839-60436861 ACTTGAAGGTCAAGGGTGGGAGG + Intergenic
1041695240 8:60728964-60728986 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1041715754 8:60930628-60930650 ACTTGAGGGTAAAGGGTGGGGGG - Intergenic
1041791877 8:61705240-61705262 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1041895007 8:62914339-62914361 ACTTGAGGGTAGAGGATGGGAGG + Intronic
1041914034 8:63121687-63121709 CCTTGAGGGAGGAGGGTGGGAGG - Intergenic
1042046303 8:64656005-64656027 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1042371940 8:68001937-68001959 ACTTGAGGGCGGAGGGTGGGAGG + Intronic
1042499373 8:69491939-69491961 CCTTGAAGGAAGTGGGTGTGAGG + Intronic
1042626251 8:70760860-70760882 ACCAGAAGGCAGAGGGTGGGAGG - Intronic
1043227729 8:77752998-77753020 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1043337088 8:79189464-79189486 GCTTGAGGGTAGAGGATGGGAGG + Intergenic
1043407815 8:79956627-79956649 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1043569433 8:81585989-81586011 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1043636786 8:82394337-82394359 GCTTGACGGTGGAGGGTGGGTGG - Intergenic
1043968226 8:86503274-86503296 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
1044307598 8:90656038-90656060 ACTTGATGGTAGAGGGTTGGAGG + Intronic
1044739124 8:95307624-95307646 ACTGGATGGCAGAGCGTGGGAGG - Intergenic
1045239440 8:100386247-100386269 CCTTGAGGGTGGAAGGTGGGAGG + Intronic
1045412945 8:101937336-101937358 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1045496914 8:102716867-102716889 ACATGGAGGCAGAGGGTTGGGGG + Intergenic
1045588120 8:103562553-103562575 CCATGAAGGCAGCGGGAGGGAGG - Intronic
1045592905 8:103618316-103618338 ACTTGAATGGGGAGGGTGGGAGG + Intronic
1045619553 8:103958399-103958421 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1045636880 8:104201126-104201148 ACTTGAGGGGAGAGGGTGGGAGG - Intronic
1045813254 8:106249339-106249361 ACCTGAGGGGAGAGGGTGGGAGG + Intergenic
1045945867 8:107795201-107795223 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1045952912 8:107871899-107871921 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1046048196 8:108987978-108988000 ACTTGAGGGTAGAGGGAGGGAGG + Intergenic
1046195350 8:110856706-110856728 ACATGAGGGCAGAGGGTGGAAGG + Intergenic
1046225297 8:111270945-111270967 ACTTGAAGGTGGAGGGAGGGAGG - Intergenic
1046282652 8:112053864-112053886 ACTTGAGGGTAGAGAGTGGGAGG - Intergenic
1046290742 8:112156611-112156633 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1046720385 8:117612485-117612507 CCTGGGAGGCAGAGGTTGGGAGG - Intergenic
1046748025 8:117896941-117896963 ACATGGAGGCAGAGGCTGGGGGG - Intronic
1046989506 8:120435363-120435385 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1047162982 8:122402312-122402334 TCTTGAGGGTGGAGGGTGGGAGG + Intergenic
1047169123 8:122473482-122473504 ACTGGAAGGTGGAGGGTGGGAGG + Intergenic
1047264891 8:123297240-123297262 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1047595016 8:126369656-126369678 TCTTGAGGGTGGAGGGTGGGAGG - Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1048236578 8:132696884-132696906 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1048335544 8:133499582-133499604 CCCTGAAGGATGAGGATGGGTGG + Intronic
1048600572 8:135915172-135915194 GTTTGAAGGTGGAGGGTGGGAGG + Intergenic
1048716102 8:137272030-137272052 GCTTGGGGGCAGAGGGTGGGAGG + Intergenic
1048723039 8:137348929-137348951 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1048754578 8:137723440-137723462 ACTTGAGGACAGAGGGTGGGAGG - Intergenic
1049115780 8:140686234-140686256 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1049178309 8:141207115-141207137 CCAGGAAGGCAGAGGGCAGGAGG + Intergenic
1049319739 8:141989736-141989758 CCTGGAGGGGAGAGGGTGGTGGG - Intergenic
1049580395 8:143408157-143408179 CCGGGAAGGGAAAGGGTGGGCGG - Intergenic
1049591590 8:143465291-143465313 CCAGGAAGGCAGGGGGTGGACGG - Intronic
1049652670 8:143780470-143780492 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1049683292 8:143929336-143929358 CCTTGAAGGCCAAAGGAGGGAGG + Intronic
1050145445 9:2562357-2562379 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1050175332 9:2864182-2864204 CTTGGAAGGCAGAGGATGGGAGG + Intergenic
1050498082 9:6265539-6265561 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1050536154 9:6632727-6632749 GCTTGCAGGCAGAATGTGGGTGG + Intronic
1050877486 9:10656894-10656916 CCATGTAGGCAGAGGAAGGGTGG + Intergenic
1050928070 9:11290892-11290914 GCTTGAGGGTAGAGAGTGGGAGG - Intergenic
1050975559 9:11933423-11933445 ACTTGAAAGTAGAAGGTGGGAGG + Intergenic
1051474821 9:17494517-17494539 ATTTGACGGTAGAGGGTGGGAGG - Intronic
1051551874 9:18338770-18338792 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
1051777326 9:20650208-20650230 CCTGGAGGGCAGAAAGTGGGAGG + Intergenic
1051782807 9:20708665-20708687 CTTGGAAGGCTGAGGATGGGCGG + Intronic
1051891997 9:21951894-21951916 ACTTGAGGGCGGAGGGTGGGAGG + Intronic
1052071458 9:24086783-24086805 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1052377674 9:27735884-27735906 ACTAGATGGGAGAGGGTGGGAGG - Intergenic
1052429278 9:28346197-28346219 ACTTGAAGACTGAGGGTGGGAGG - Intronic
1052626822 9:30986034-30986056 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
1052735477 9:32338042-32338064 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1052795624 9:32920937-32920959 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1052804759 9:33002875-33002897 CCTTCAAGACAGAAGGTGGGAGG + Intronic
1053291519 9:36882544-36882566 CTTTGAAGGCAGGTGGTGGCAGG - Intronic
1053531255 9:38883848-38883870 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1053822561 9:41983035-41983057 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1054203479 9:62108280-62108302 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1054608015 9:67204331-67204353 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1054634883 9:67480084-67480106 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1054932475 9:70650152-70650174 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1055186330 9:73459439-73459461 GCTTGAACGCAGGAGGTGGGGGG + Intergenic
1055226293 9:74001348-74001370 GCTTGAAGGCAGAGGCAGGGAGG - Intergenic
1055356467 9:75442673-75442695 ATTGGAAGGCAGAGGGTGGGAGG - Intergenic
1055361956 9:75501136-75501158 ACTTGAAGGTGGAGGGTGAGAGG - Intergenic
1055369890 9:75586220-75586242 CCCTGAGGGTGGAGGGTGGGAGG + Intergenic
1055624131 9:78155756-78155778 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1055829667 9:80363126-80363148 CCTAGAAGGGAGAGGGAGGGGGG - Intergenic
1055935213 9:81598359-81598381 CGTGGCAGGCAGAGGGAGGGAGG - Intronic
1055990984 9:82105344-82105366 ACTTGAGGGTGGAGGGTGGGTGG - Intergenic
1056298868 9:85221364-85221386 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1056436847 9:86582908-86582930 ACTGGAGGGCAGAGGGTAGGAGG + Intergenic
1056507698 9:87272963-87272985 CCTTGAAGGTGGAGGGTGGGAGG + Intergenic
1056959504 9:91110354-91110376 ACTTGAAGGAAGAGGGTGGGAGG + Intergenic
1057083589 9:92189743-92189765 CCTCGGAGGCAGAGGGCAGGGGG - Intergenic
1057117626 9:92540693-92540715 CCTGGGAGGCAGAGGTTGTGGGG + Intronic
1057360314 9:94367302-94367324 ACTTGAGGGTGGAGGGTGGGGGG - Intergenic
1057395135 9:94673498-94673520 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1057408042 9:94791335-94791357 GCTTGAGGGTGGAGGGTGGGAGG + Intronic
1057663026 9:97020775-97020797 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1057892633 9:98880879-98880901 ACTTGAAGGTAGTGGATGGGAGG + Intergenic
1058547084 9:106072143-106072165 CCTGGAAGGCAGAGGTTGTGGGG + Intergenic
1058831364 9:108820213-108820235 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1059003328 9:110374148-110374170 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
1059083973 9:111280258-111280280 CCTTGAGGGTGGAGGGTGGGAGG - Intergenic
1059095958 9:111415028-111415050 ACTTGAGGAGAGAGGGTGGGAGG + Intronic
1059515043 9:114885812-114885834 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1059527541 9:115006461-115006483 GCTTGATGGCTGAAGGTGGGAGG - Intergenic
1059839759 9:118200761-118200783 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1059916871 9:119113682-119113704 GCTTGAGGGTAGAGAGTGGGGGG + Intergenic
1060080617 9:120640853-120640875 ACTAGAAGGGGGAGGGTGGGCGG - Intronic
1060088967 9:120726219-120726241 CCTTGAAGGGAGATGGATGGAGG - Intergenic
1060342963 9:122792976-122792998 CCTTGAAGGGAGAGTGTAGAGGG - Intergenic
1060538462 9:124411957-124411979 CCCTAAAGGGAGGGGGTGGGGGG + Intronic
1060564948 9:124582411-124582433 ACCAGAGGGCAGAGGGTGGGAGG + Intronic
1060570212 9:124631813-124631835 ACCAGAGGGCAGAGGGTGGGAGG - Intronic
1060720461 9:125973055-125973077 CCTTGAAGGTTGGGGGTGGCAGG - Intergenic
1060813059 9:126620676-126620698 CCTTGGGGGCAGACGGAGGGTGG + Intronic
1061014600 9:127974480-127974502 CCTTGAAGGCAGAGGGGAATTGG - Intronic
1061183774 9:129040254-129040276 CCTGGTAGGCAGAGGGTCTGTGG + Intronic
1061234209 9:129333145-129333167 CCTGGGAGGCAGAGGCTGCGGGG - Intergenic
1061395684 9:130342276-130342298 CCTTGGAGGCAGGGGTTGAGGGG + Intronic
1061425866 9:130498070-130498092 CCTTGAAGCCGGTGGGTGCGTGG - Intronic
1061566612 9:131444883-131444905 CCTTGGAAGCCGAGGGTGGCTGG + Intronic
1061616200 9:131780884-131780906 ACTTGAGGGTAGAGGGTGGGCGG + Intergenic
1061684596 9:132264724-132264746 CCTTGGAGTCAGAGGGTGTGTGG + Exonic
1062043654 9:134415454-134415476 TCTGGAAGCCAGAGGGTGGGAGG + Intronic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1062299160 9:135854916-135854938 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
1062390737 9:136332734-136332756 CCTGGCAGGTAGTGGGTGGGAGG + Intronic
1062564862 9:137159801-137159823 GCCTGGAGGCTGAGGGTGGGCGG + Intronic
1202790648 9_KI270719v1_random:88641-88663 CCATGAGGGCAGAGGGCGAGAGG + Intergenic
1203415620 Un_KI270582v1:4092-4114 ATTTGAAGTAAGAGGGTGGGAGG - Intergenic
1185693193 X:2173731-2173753 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1185843942 X:3419533-3419555 GCTTGAAGGGGGAGGGTGGGAGG - Intergenic
1185918882 X:4066923-4066945 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1185919013 X:4068397-4068419 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1185926168 X:4149374-4149396 ACCAGAAGTCAGAGGGTGGGAGG - Intergenic
1185943065 X:4342640-4342662 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic
1186012480 X:5150501-5150523 GCTTGAGGGTGGAGGGTGGGAGG - Intergenic
1186457003 X:9717569-9717591 CCTTGAGGCCAGAGGGCGCGCGG - Exonic
1186605634 X:11087588-11087610 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1186616668 X:11195655-11195677 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1186627894 X:11314782-11314804 CTCAGAAGGTAGAGGGTGGGAGG + Intronic
1186632400 X:11364198-11364220 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1186881602 X:13872276-13872298 CGTGGAAGGCTGAAGGTGGGAGG - Intronic
1186904970 X:14101060-14101082 ACTTGAAGGTAGAGAGTGGGAGG - Intergenic
1186921004 X:14280251-14280273 ACTTGAGGGTAGAGGGCGGGAGG - Intergenic
1187035392 X:15533340-15533362 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1187053639 X:15718827-15718849 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1187054288 X:15727336-15727358 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1187301263 X:18052393-18052415 CCTTGAGGGTGGAGGATGGGAGG - Intergenic
1187746430 X:22414222-22414244 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1187756430 X:22532175-22532197 ACTTGAGGGTAGAAGGTGGGAGG + Intergenic
1187793509 X:22976949-22976971 ACTTGAGGGAGGAGGGTGGGAGG + Intergenic
1187889144 X:23917257-23917279 CCCTGGAGGCAGAGGTTGTGGGG + Intronic
1188043569 X:25399289-25399311 ACTAGAAGGCAGAGGGAGGAAGG + Intergenic
1188362307 X:29271008-29271030 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1188471019 X:30539277-30539299 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1188516577 X:30994013-30994035 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1188810566 X:34649544-34649566 ACTTGAGGGTTGAGGGTGGGAGG + Intronic
1188828940 X:34872555-34872577 ACTTGAGGGTAGAGTGTGGGAGG + Intergenic
1189106964 X:38246530-38246552 CCTTGAGGGTGAAGGGTGGGAGG + Intronic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1189220044 X:39363731-39363753 ACTTGATGGGGGAGGGTGGGAGG + Intergenic
1189323765 X:40101069-40101091 GCTATAAGGCAGAGGGGGGGAGG + Intronic
1189402829 X:40688139-40688161 CCTAGGAGGCAGAGGTTGGGAGG + Intronic
1189584163 X:42440697-42440719 CCTTGAGGGTGGAAGGTGGGAGG + Intergenic
1189587911 X:42479599-42479621 ACTTGAAGCCAGGAGGTGGGAGG + Intergenic
1189638734 X:43043917-43043939 CCTTGAGGGTAGAGGGTGGGGGG - Intergenic
1190127526 X:47720025-47720047 ACTTGACGGTGGAGGGTGGGAGG + Intergenic
1190159302 X:48018755-48018777 ACTTGAAGGTGGAGGGTGGGAGG + Intronic
1190175015 X:48140984-48141006 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1190289643 X:48983737-48983759 GGTTGAAGGGAGAGGATGGGGGG - Intronic
1190447934 X:50549240-50549262 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1190600134 X:52083374-52083396 ACTGGAGGGCAGAGGGTGGGAGG - Intergenic
1191147461 X:57183055-57183077 ACCTGAGGGCAGAAGGTGGGAGG + Intergenic
1191206434 X:57838725-57838747 ACTTGAAAGTGGAGGGTGGGAGG - Intergenic
1191738373 X:64411048-64411070 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1191744590 X:64472597-64472619 ACTTGAAGGTGGAAGGTGGGAGG - Intergenic
1191763810 X:64673687-64673709 ACTTGAGGGTTGAGGGTGGGTGG + Intergenic
1191867209 X:65713777-65713799 CATAGAAGGTGGAGGGTGGGAGG - Intronic
1191910118 X:66141156-66141178 ATTTGAAGGTGGAGGGTGGGAGG - Intergenic
1191926423 X:66315750-66315772 ACTTGAGAGTAGAGGGTGGGAGG + Intergenic
1192229446 X:69255064-69255086 GATTAAAGGCAGAGGATGGGTGG + Intergenic
1192354820 X:70391765-70391787 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1192397756 X:70800237-70800259 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1192439459 X:71164095-71164117 CAATGAAGGCAGAGGGATGGAGG - Intronic
1192488139 X:71548751-71548773 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1192837835 X:74820859-74820881 ACCTGAGGGCAGAGGGTGGAAGG + Intronic
1192892435 X:75405223-75405245 ACTTGAGGGCAGGGGGTGAGAGG + Intronic
1193085162 X:77442401-77442423 ACTTGAAGGTGGAGGGTGGAGGG - Intergenic
1193186359 X:78517907-78517929 CCTTGAAGGCAGAATGTGAGAGG + Intergenic
1193318073 X:80087865-80087887 TATTGAAGGTAGAGGGTGGGAGG - Intergenic
1193478141 X:81993050-81993072 ATTGGAAGGTAGAGGGTGGGAGG - Intergenic
1193637181 X:83965974-83965996 ACTTGAGGATAGAGGGTGGGAGG + Intergenic
1193674349 X:84431015-84431037 ACTTGAAGGTGGAAGGTGGGAGG - Intronic
1193722192 X:85000274-85000296 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1193748742 X:85316870-85316892 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1193825374 X:86219456-86219478 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1193883427 X:86955443-86955465 ACTTGAAGGGGGAGAGTGGGAGG + Intergenic
1194212652 X:91087754-91087776 TCTTGAGGTGAGAGGGTGGGAGG - Intergenic
1194374726 X:93118116-93118138 TCTTGGAGGTGGAGGGTGGGAGG + Intergenic
1194407188 X:93511266-93511288 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1194442159 X:93946145-93946167 CCAAGAAGGTAGAGGGTTGGAGG + Intergenic
1194484208 X:94467075-94467097 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
1194503938 X:94709554-94709576 CAATGAAGGCAGAGGGTGAAAGG + Intergenic
1194593451 X:95830013-95830035 GCTTGAGGGTGGAGGGTGGGAGG - Intergenic
1194597339 X:95874665-95874687 CTCAGAAGGGAGAGGGTGGGAGG + Intergenic
1194900336 X:99501867-99501889 ACTTGAAGGCAGAGGATGGGAGG + Intergenic
1195177183 X:102322596-102322618 GTTTGAAGGCAGAGTGGGGGTGG - Intronic
1195181681 X:102364497-102364519 GTTTGAAGGCAGAGTGGGGGTGG + Intronic
1195413792 X:104598270-104598292 GCTGGAAGGCAGAGGGTTGTAGG + Intronic
1195448557 X:104981984-104982006 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1195467675 X:105197910-105197932 CCTTGAGGGTGGAGAGTGGGAGG - Intronic
1195909372 X:109874468-109874490 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1195979725 X:110564359-110564381 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1196080696 X:111627628-111627650 ACTTGAGGGCGGAGGGTGAGAGG + Intergenic
1196216812 X:113062396-113062418 ACTGGAGGGCAGAGAGTGGGAGG - Intergenic
1196303245 X:114070478-114070500 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
1196575603 X:117314805-117314827 ACTTGAGGGGGGAGGGTGGGAGG - Intergenic
1197122795 X:122912122-122912144 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1197177010 X:123496731-123496753 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1197259265 X:124299694-124299716 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1197353596 X:125406338-125406360 ACTTGAGGGTAGAGGGTGAGAGG - Intergenic
1197553396 X:127923041-127923063 CCTTGAAGGTGGATGGAGGGAGG + Intergenic
1197791074 X:130254754-130254776 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1197984446 X:132252929-132252951 ACTTGAGGACGGAGGGTGGGAGG + Intergenic
1198068432 X:133123361-133123383 TCTTGAGGGTGGAGGGTGGGAGG - Intergenic
1198076574 X:133199050-133199072 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1198320129 X:135512106-135512128 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1198443892 X:136692073-136692095 CCACGAAGGGAGAGTGTGGGTGG - Intronic
1198528110 X:137522491-137522513 ACTTGAGGGTAGAGGTTGGGAGG - Intergenic
1198672024 X:139091326-139091348 CTCTGCAAGCAGAGGGTGGGAGG + Intronic
1198722295 X:139635870-139635892 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1198843413 X:140882918-140882940 CCTTAAGGGTAGAGAGTGGGAGG + Intergenic
1198945458 X:142008158-142008180 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1199193591 X:145001240-145001262 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1199217029 X:145271620-145271642 AATTGAAGGTGGAGGGTGGGAGG + Intergenic
1199257751 X:145735985-145736007 ACTTGAGGACAGAGGGTGGGAGG + Intergenic
1199271902 X:145893843-145893865 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
1199338467 X:146647205-146647227 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1199469142 X:148174530-148174552 ACTTGAGGGTAGAGGGTGAGAGG - Intergenic
1200047341 X:153409919-153409941 CCATGGAGGCAGGGGGCGGGGGG - Intergenic
1200101235 X:153689882-153689904 GGTCTAAGGCAGAGGGTGGGTGG - Intronic
1200215325 X:154365702-154365724 CTTGGAAGGGGGAGGGTGGGGGG - Intronic
1200341056 X:155395996-155396018 ACTTGAAAGTGGAGGGTGGGAGG + Intergenic
1200383269 X:155862125-155862147 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1200604872 Y:5250608-5250630 ACTGGAAGGTGGAGGGTGGGAGG + Intronic
1200682750 Y:6232182-6232204 TCTTGGAGGTGGAGGGTGGGAGG + Intergenic
1200819577 Y:7568645-7568667 ACTTGAAGGGGGAGGGTGGGAGG + Intergenic
1201248262 Y:12028721-12028743 ACTTGAGGGGGGAGGGTGGGAGG + Intergenic
1201294505 Y:12452162-12452184 ACTTGAAGGCAGAGGGTGGGAGG + Intergenic
1201610187 Y:15833937-15833959 TCTTGAAGCAAGAAGGTGGGTGG + Intergenic
1201727986 Y:17174576-17174598 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic
1201762108 Y:17551775-17551797 ACTTGATGGAGGAGGGTGGGAGG + Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1201839444 Y:18354213-18354235 ACTTGATGGAGGAGGGTGGGAGG - Intergenic
1201853441 Y:18514867-18514889 CCTGGAAGGCAGAGGCTGCTGGG + Intergenic
1201879880 Y:18805517-18805539 CCTGGAAGGCAGAGGCTGCTGGG - Intronic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic