ID: 966517126

View in Genome Browser
Species Human (GRCh38)
Location 3:180830183-180830205
Sequence TGCTGCAGCAGCAGAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1316
Summary {0: 1, 1: 0, 2: 14, 3: 126, 4: 1175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966517126_966517129 -4 Left 966517126 3:180830183-180830205 CCTCAGCCTCTGCTGCTGCAGCA 0: 1
1: 0
2: 14
3: 126
4: 1175
Right 966517129 3:180830202-180830224 AGCAGCAGGCGTCAACCTCAAGG 0: 1
1: 0
2: 0
3: 14
4: 125
966517126_966517130 2 Left 966517126 3:180830183-180830205 CCTCAGCCTCTGCTGCTGCAGCA 0: 1
1: 0
2: 14
3: 126
4: 1175
Right 966517130 3:180830208-180830230 AGGCGTCAACCTCAAGGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 150
966517126_966517131 8 Left 966517126 3:180830183-180830205 CCTCAGCCTCTGCTGCTGCAGCA 0: 1
1: 0
2: 14
3: 126
4: 1175
Right 966517131 3:180830214-180830236 CAACCTCAAGGCCCAGGCCACGG 0: 1
1: 0
2: 5
3: 28
4: 309
966517126_966517135 23 Left 966517126 3:180830183-180830205 CCTCAGCCTCTGCTGCTGCAGCA 0: 1
1: 0
2: 14
3: 126
4: 1175
Right 966517135 3:180830229-180830251 GGCCACGGCCACCCCGACCCCGG 0: 1
1: 0
2: 4
3: 29
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966517126 Original CRISPR TGCTGCAGCAGCAGAGGCTG AGG (reversed) Intronic
900150201 1:1175284-1175306 TTCTGCAGCAGAAGAGACGGAGG + Intronic
900188383 1:1343306-1343328 TGCTGCTGCTGAGGAGGCTGGGG - Intronic
900372752 1:2339535-2339557 TGCTGCAGCTGCAGAAATTGTGG - Intronic
900647633 1:3716120-3716142 TGCTAGAGCCCCAGAGGCTGTGG - Intronic
900722624 1:4187262-4187284 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
900767847 1:4517482-4517504 AGCTGCAGCAGCAGGGGCCAGGG - Intergenic
900831232 1:4967160-4967182 TGGAGGAGCAGCAGAGGCCGGGG - Intergenic
900847384 1:5114833-5114855 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
900919749 1:5662702-5662724 TCCAGCAGCAGCAGAGGGTGGGG + Intergenic
901015253 1:6225664-6225686 TCGTGCTGAAGCAGAGGCTGTGG - Intronic
901057500 1:6455467-6455489 TGCGGCAGCTGCTGAGGCAGCGG + Intronic
901236136 1:7668580-7668602 TGCTGCAGCAGGAGTGTCAGTGG - Intronic
901238723 1:7680869-7680891 AGCAGCAGCAGCAGCTGCTGCGG + Intronic
901317362 1:8318110-8318132 TGCTGCAGCAGCCGGGACCGCGG + Intronic
901420899 1:9150422-9150444 GGGAGAAGCAGCAGAGGCTGGGG + Intergenic
901463218 1:9404147-9404169 TGCTGCTGGAGACGAGGCTGGGG + Intergenic
901777690 1:11571460-11571482 TGCTCCAGAAGCAGACTCTGCGG + Intergenic
901981202 1:13035147-13035169 TGCTGCTGCAGCAGTGGGTTGGG - Intronic
902000884 1:13193782-13193804 TGCTGCTGCAGCAGTGGGTTGGG + Intergenic
902048967 1:13546903-13546925 TGCTCCTGCAGGAGAGGCTTTGG - Intergenic
902394060 1:16122806-16122828 TCCTGCAGCAGCAGGGGCCAGGG + Intergenic
902450022 1:16491010-16491032 AGCTGGAGCAGCAGCGGCTAAGG - Intergenic
902472200 1:16656874-16656896 AGCTGGAGCAGCAGCAGCTGAGG - Intergenic
902476860 1:16693011-16693033 TGCGGCAGCTGCTGAGGCAGCGG - Intergenic
902486603 1:16750572-16750594 AGCTGGAGCAGCAGCAGCTGAGG + Intronic
902504443 1:16930185-16930207 AGCTGGAGCAGCAGCGGCTGAGG + Exonic
902585852 1:17438369-17438391 TGCAGTAGCAGCAGCGGCGGCGG - Exonic
902682129 1:18050902-18050924 TGCTCCATCTGCAGAGCCTGGGG - Intergenic
903175478 1:21577740-21577762 TCTTGCAGTTGCAGAGGCTGAGG - Exonic
903211892 1:21823359-21823381 TGCTGCAGGTCCAGGGGCTGTGG + Exonic
903457794 1:23500053-23500075 TGAGGCAGTAGCTGAGGCTGAGG + Intergenic
903548476 1:24141716-24141738 TGCCGAAGCAACACAGGCTGAGG - Intronic
903925242 1:26826943-26826965 CGCTGGAGCAGCAGCGGCAGCGG + Exonic
904026239 1:27505334-27505356 GGCGGGAGCAGCAGAAGCTGAGG - Intergenic
904443619 1:30550410-30550432 TGAGGCTGCAGCAGAGGCTCTGG - Intergenic
904626659 1:31809925-31809947 TGTTGCAGGAGTAGAGGGTGGGG - Intronic
904832552 1:33314431-33314453 TGGGGCAGCAGGAGAGGCAGGGG - Intronic
904941023 1:34164946-34164968 AGCAACAGCAGCAGAGGCGGCGG + Exonic
905104902 1:35558428-35558450 AGCAGCAGCAGCAGCGGCGGCGG - Intronic
905104903 1:35558431-35558453 TGCAGCAGCAGCAGCAGCGGCGG - Intronic
905104904 1:35558434-35558456 GGCTGCAGCAGCAGCAGCAGCGG - Intronic
905175660 1:36134013-36134035 GGCCGCTGCAGCAGAGGTTGGGG - Intergenic
905274007 1:36805489-36805511 AGCTGCATCAGCAGGGGCAGGGG + Intronic
905418548 1:37822351-37822373 TTCTGCATCAGCAGCGGCAGTGG - Exonic
905491440 1:38346991-38347013 TGCTGCTGGGGCTGAGGCTGGGG - Intergenic
905499699 1:38426791-38426813 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
905524143 1:38623824-38623846 TTCTCCAGAAGCAGAGGCTGAGG - Intergenic
905864441 1:41369046-41369068 TTCTGGAGCAGGAGAGCCTGGGG - Intronic
906087546 1:43148686-43148708 TTCTGGAGCAGCAGAGAGTGGGG - Intronic
906148588 1:43574770-43574792 TCCTGCAGATGCAGAGGCAGGGG - Intronic
906190946 1:43899162-43899184 AGCGGCGGCAGCGGAGGCTGAGG - Exonic
906509363 1:46402127-46402149 TTCTGCACCAGCTGAGGCAGGGG - Exonic
906560360 1:46752226-46752248 TGCTCCAGCAGCTGAGTCTGAGG - Intergenic
906692459 1:47801572-47801594 TGCTGCAGCAGGAGAGTGTGCGG - Exonic
906707760 1:47907148-47907170 AGCTCCAGCAGCTGGGGCTGCGG + Intronic
907371300 1:54005245-54005267 TGCCACAGCAGCAGACCCTGCGG + Intergenic
907503642 1:54901864-54901886 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
907523432 1:55039871-55039893 AGCAGCAGCAGCAGTGGCAGCGG - Exonic
908132056 1:61083356-61083378 GGCTGCGGCAGCGCAGGCTGCGG - Intronic
908170682 1:61501568-61501590 TCCTTCAGCTGCAGAGCCTGAGG - Intergenic
908184871 1:61642750-61642772 AGCAGCATGAGCAGAGGCTGTGG - Intergenic
908461788 1:64353964-64353986 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
908592028 1:65645871-65645893 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
908748260 1:67396151-67396173 AGCTGCTGGAGCAGGGGCTGGGG - Exonic
908852327 1:68387980-68388002 GGGTGGAGAAGCAGAGGCTGAGG - Intergenic
909695606 1:78465271-78465293 TGCTGCAGTGGCAATGGCTGAGG + Intronic
909776773 1:79492559-79492581 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
909788342 1:79642748-79642770 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
909909883 1:81247153-81247175 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
909978526 1:82071495-82071517 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
911375207 1:97043772-97043794 AGCTGCAGCAGCAGTGGCAGAGG + Intergenic
912716937 1:111989775-111989797 GGCTGGAGCGGCGGAGGCTGCGG - Intergenic
914907258 1:151756749-151756771 AGCTACAGCAGCAGAGGCTGTGG + Intergenic
914950862 1:152112314-152112336 AGCAGCAGCAGCAAAGGCTGAGG - Exonic
915065492 1:153221061-153221083 GGCTGCAGCAGCAGTGGCCCAGG - Intergenic
915288877 1:154869753-154869775 TGCTGCTGCTGCTGAAGCTGCGG + Exonic
915288879 1:154869762-154869784 TGCTGAAGCTGCGGAGGCTGAGG + Exonic
915457465 1:156050471-156050493 AGCTGCAGCAGCAGATGCAGCGG - Exonic
915462909 1:156080653-156080675 TGCTGGAGCAGCAGAGGGTGTGG + Intronic
915552284 1:156642170-156642192 TGCAGCTGCAGCTGAGACTGCGG - Exonic
915637329 1:157195822-157195844 AGCTGCAGCAGCCCAGGTTGTGG + Intergenic
915734702 1:158077455-158077477 TCCTGCAGAAGCAGTGGCTGAGG - Intronic
915815776 1:158963164-158963186 CACTGCAGCAGCAGTGGCAGAGG - Intronic
915839215 1:159201754-159201776 TGCTCCAGCAGCAGTGGGAGAGG + Exonic
915926037 1:160020359-160020381 TGCTGATGCGGCAGAGGCTGTGG - Intergenic
915927120 1:160031380-160031402 TGCTGCTGCTGAAGGGGCTGGGG - Exonic
915939648 1:160110750-160110772 TGCAGCACAGGCAGAGGCTGGGG + Intergenic
916147217 1:161750366-161750388 TCCTGCAGCAGCAGAGGGCGGGG + Intronic
916354174 1:163885707-163885729 AGGTGCAGCAGGAGTGGCTGCGG - Intergenic
916548906 1:165830990-165831012 TGCTGCAGGTCTAGAGGCTGAGG + Intronic
916619841 1:166485316-166485338 TACTGCAGGAGAAGAGGATGTGG + Intergenic
917612367 1:176701622-176701644 TGCTGCATCAGCTGAGGGAGTGG + Intronic
918152415 1:181809321-181809343 GCCTGCAGAAGCAGAGGATGGGG - Intergenic
918347036 1:183615362-183615384 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
918567753 1:185952296-185952318 GGGTGGAGGAGCAGAGGCTGAGG + Intronic
918714486 1:187769493-187769515 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
919476322 1:198036507-198036529 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
919704178 1:200660465-200660487 TGCTGCAGCCTGAGGGGCTGAGG + Intronic
919766173 1:201128543-201128565 CACTGCAGCAGCAGAGCCTTGGG + Intergenic
920171741 1:204076239-204076261 TGATCCAGCAGCCCAGGCTGAGG - Intronic
920688692 1:208129393-208129415 TGTTGTAGCAGCTGGGGCTGGGG + Intronic
920829324 1:209450650-209450672 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
921189849 1:212699674-212699696 TGCTGCTGCGGCTGCGGCTGCGG + Exonic
921203383 1:212827565-212827587 TGCTTGAGCAGGAGAGGTTGAGG + Intergenic
921459860 1:215413939-215413961 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
921520053 1:216147261-216147283 GGGTGGAGGAGCAGAGGCTGAGG - Intronic
921638040 1:217520952-217520974 TGCTCCAGCAGCAGAGGCAGGGG - Intronic
921733050 1:218597788-218597810 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
921848384 1:219907825-219907847 TCCTGCAACAGTACAGGCTGAGG + Intronic
922049614 1:221977102-221977124 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
922154148 1:223028400-223028422 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
922288700 1:224192170-224192192 AGCAGCAGCAGCAGCAGCTGTGG - Intronic
922305602 1:224341216-224341238 TGCAGGAGCAGCAGTGGCGGCGG - Intergenic
922536259 1:226383058-226383080 AGCAGCAGGAGCCGAGGCTGTGG + Exonic
922561177 1:226570665-226570687 TGCTGCAGCTCCAGGTGCTGGGG - Intronic
922779647 1:228241237-228241259 TGGTGAAGCAGGAGCGGCTGGGG + Intronic
922972008 1:229750181-229750203 AGCTCCAGCAGCCCAGGCTGTGG + Intergenic
923075127 1:230602943-230602965 GGGTGAAGGAGCAGAGGCTGAGG - Intergenic
923770817 1:236936251-236936273 GGGTGGAGTAGCAGAGGCTGAGG + Intergenic
923962707 1:239103055-239103077 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1062791828 10:311552-311574 TGCTGTAGCCTCACAGGCTGTGG - Intronic
1062939127 10:1408878-1408900 TGCTGCAGGCTCAGAGGATGAGG + Intronic
1063029138 10:2214455-2214477 TGCTTCAGGAGCAGAGGGTATGG - Intergenic
1063162349 10:3428198-3428220 TTCAGCAGCTGCAGAGGCGGAGG + Intergenic
1063509679 10:6633591-6633613 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1063791004 10:9447751-9447773 AGATGCAGAAGAAGAGGCTGGGG - Intergenic
1064185469 10:13158436-13158458 GGCAGCAGCAGCAGCGGCGGCGG - Intergenic
1064185470 10:13158439-13158461 TGCGGCAGCAGCAGCAGCGGCGG - Intergenic
1064286232 10:13993888-13993910 TGCTGCAGCTGGAGGGCCTGAGG + Intronic
1064645438 10:17454579-17454601 GGCGGCAGCAGCAGTGGCAGCGG - Intergenic
1064701177 10:18023466-18023488 TGCTGCTACAGCAGTGGCAGAGG + Intronic
1064806459 10:19139728-19139750 TGCTGCAGCAGCAGACTCCATGG + Intronic
1065854588 10:29820059-29820081 TGATTCAGCAGCTGAGGCTGAGG - Intergenic
1066156455 10:32683707-32683729 TGCTGCAGCAGCAATGGCAGAGG + Intronic
1066616499 10:37300320-37300342 TGCAGAAGCAGCTGAGGCTCTGG + Intronic
1066617226 10:37307712-37307734 TGCTGCAGGGACAGATGCTGGGG + Intronic
1066621877 10:37363833-37363855 AGCTACAGGAGCTGAGGCTGAGG + Intronic
1066746104 10:38604942-38604964 ACCTGCAGCACCAGGGGCTGTGG - Intergenic
1067560355 10:47300691-47300713 AGCAGCAGCAGCAGCAGCTGGGG - Exonic
1068058425 10:52037760-52037782 GGGTGGAGGAGCAGAGGCTGAGG + Intronic
1068179732 10:53503031-53503053 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1068230896 10:54168469-54168491 GGGTGGAGGAGCAGAGGCTGAGG - Intronic
1068681573 10:59825953-59825975 TGCTGCAGCTGTAGATGATGAGG + Intronic
1069933733 10:71900946-71900968 CGCTGCAGCTGCTGAGCCTGGGG + Intergenic
1070214630 10:74363923-74363945 TACTGCAGCAGGAGGAGCTGAGG + Intronic
1070311175 10:75275290-75275312 TGCTGCAGCATCTGAGGGTCCGG + Intergenic
1070408668 10:76119321-76119343 TGCTTCTGCTGCTGAGGCTGGGG + Intronic
1070474853 10:76820283-76820305 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1070648142 10:78215674-78215696 TGCCCCAGCTGCAGAGGTTGGGG - Intergenic
1070816652 10:79328652-79328674 TGTGGCAGCAGCAGAGGTGGGGG - Intergenic
1070835671 10:79445588-79445610 GGCGGCAGCGGCAGCGGCTGCGG - Exonic
1071296229 10:84222093-84222115 TGCTGCAGCTGCAGGGGCCCTGG + Exonic
1071857868 10:89644665-89644687 TGCTGAGGGAGCAGTGGCTGCGG + Exonic
1071897807 10:90085037-90085059 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1071956834 10:90769980-90770002 TGCGGGAGCAGCAGTGGCAGTGG + Intronic
1072578568 10:96720902-96720924 TGCTGGGGCAGCAGGGGCTTAGG - Intergenic
1072733744 10:97865638-97865660 AGCGGCAGCAGCAGCGGCAGTGG + Exonic
1073094206 10:100969903-100969925 AGCTGCAGCAGTAGAGACTGAGG + Intronic
1073129977 10:101181900-101181922 TGCTGCAGGAGCTGAGGGGGTGG + Intergenic
1073258010 10:102167450-102167472 TGCTTGAGCCCCAGAGGCTGAGG - Intergenic
1073394499 10:103206902-103206924 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1073512283 10:104050332-104050354 TTGTGCAACAGCAGGGGCTGGGG - Intronic
1074064925 10:110006009-110006031 AGCAGCAGCAGCAGCGGCGGCGG - Intronic
1074248143 10:111714570-111714592 GTCTGGAGCAGCAGAGGCTCAGG + Intergenic
1074328600 10:112479379-112479401 TGCGGCAGAAGCAGGGGTTGGGG - Intronic
1074503103 10:114043909-114043931 GGCTCCAGCAGCAGCGGCGGCGG + Intergenic
1074750191 10:116578477-116578499 TGCTGAAGCAGCCGAGTCTTGGG - Intergenic
1074903558 10:117840341-117840363 TGCTGAAGATGCTGAGGCTGTGG - Intergenic
1075100587 10:119503499-119503521 CTGTGCAGCAGCAGAGGCTGGGG + Intronic
1075390292 10:122086592-122086614 TGATGCAGCAGGAGAGACAGAGG + Exonic
1075403856 10:122180854-122180876 AGCTGAGGCAGGAGAGGCTGAGG - Intronic
1075453659 10:122570651-122570673 TGTGGCAGCAGAAGAGGTTGGGG + Intronic
1075453859 10:122572075-122572097 TGTGGCAGCAGAAGAGGTTGGGG + Intronic
1075932887 10:126314184-126314206 TGCTGGAGGAGCTGAGGGTGGGG + Intronic
1076595112 10:131620401-131620423 CCCTGCAGCTGCAGAGGGTGGGG + Intergenic
1076778276 10:132709996-132710018 AGCAGCATCAGCTGAGGCTGAGG + Intronic
1076850361 10:133089359-133089381 GGCTTCAGCAGTGGAGGCTGTGG + Intronic
1077094379 11:793121-793143 TGCTGCAGTGGCGGAGGCTGGGG - Intronic
1077168563 11:1154464-1154486 TCCTGAAGCACCAGTGGCTGGGG + Intergenic
1077184164 11:1228947-1228969 TGCAGGAGAAGGAGAGGCTGTGG + Intronic
1077213335 11:1383429-1383451 TTCCGCAGCAGCGGAGGCCGCGG + Intergenic
1077551801 11:3203718-3203740 GGCTGCAGCAGCAGGTCCTGCGG - Intergenic
1077835874 11:5928166-5928188 TGCTGCAGCGGCAGAAGCAGAGG - Intronic
1077850870 11:6073835-6073857 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1078046200 11:7916159-7916181 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1078445757 11:11403843-11403865 TGATGCTGCAGAAGAGGGTGAGG + Intronic
1078541503 11:12217148-12217170 TGCAGCAGCAGCAGTGACAGTGG - Intronic
1078579896 11:12530928-12530950 GGGTGCAGGACCAGAGGCTGGGG + Intergenic
1078643227 11:13115101-13115123 TGCTGGAGCAGAAGCTGCTGGGG - Intergenic
1078667872 11:13341132-13341154 GGCAGCAGAAGAAGAGGCTGAGG - Intronic
1079308527 11:19345215-19345237 GGCTGCAGCGGCAGCGGCCGCGG + Intergenic
1079882699 11:25945608-25945630 TGCTGCAGTGGCAGTGGCTGAGG - Intergenic
1080027984 11:27633074-27633096 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1080633969 11:34107147-34107169 TGGAGCTGCAGGAGAGGCTGAGG - Intronic
1080645090 11:34182383-34182405 TGCTGGAGGAGATGAGGCTGGGG - Intronic
1081574299 11:44309734-44309756 TGCTGCTGCGGCTGCGGCTGCGG + Exonic
1081695318 11:45105544-45105566 AGCTGTAGCAGTGGAGGCTGAGG - Intronic
1081727225 11:45338882-45338904 TGCAGAGGCAGGAGAGGCTGAGG + Intergenic
1082004554 11:47412364-47412386 TGCAGCAGCAGCAACAGCTGGGG + Exonic
1082274021 11:50201964-50201986 TGCTGCAGCAGGAAAGGTTAGGG - Intergenic
1082834079 11:57639461-57639483 AGCTGGAGCAGCAGGGGCAGGGG - Intergenic
1082889390 11:58122293-58122315 TGCTCCAGCAGCAGGGTCTGGGG + Intronic
1083374761 11:62210513-62210535 TGATGCCGCTGCAGAGGCTATGG + Exonic
1083592526 11:63904012-63904034 TGCGGCAGAAGCAGAAGCCGTGG - Exonic
1084057299 11:66643888-66643910 TGCTGCTGCAGCAGCAGCTGTGG - Exonic
1084245675 11:67855433-67855455 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1084385749 11:68841792-68841814 TGCGGCAGCGGCAGCGGCAGCGG + Exonic
1084400541 11:68940431-68940453 TGCTGAAGATGCTGAGGCTGTGG - Exonic
1084554900 11:69869662-69869684 GCCTGCAGCCGCAGAGGATGGGG + Intergenic
1084613353 11:70218309-70218331 CGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1084827011 11:71739145-71739167 GGATGGAGGAGCAGAGGCTGAGG - Intergenic
1084934881 11:72581509-72581531 TGATGGAGGAGGAGAGGCTGAGG - Intronic
1085332956 11:75668218-75668240 TGCTGCGGCGGCGGTGGCTGCGG + Exonic
1085333119 11:75669022-75669044 TGCAGCAGAGGCAGAGGCGGCGG - Exonic
1085392776 11:76190954-76190976 TGCTGCAGCAGCTGTGACTGGGG + Intronic
1085531934 11:77197109-77197131 TGCTGGTGCAGCAGAGGCGTGGG - Intronic
1085570105 11:77551610-77551632 GGGTGGAGGAGCAGAGGCTGAGG - Intronic
1086125386 11:83344120-83344142 GGATGGAGGAGCAGAGGCTGAGG + Intergenic
1086134916 11:83435607-83435629 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1086322348 11:85664337-85664359 TGCAGCAGCAGCAGTGACAGTGG - Exonic
1087099024 11:94347400-94347422 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1087314603 11:96589639-96589661 GGGTGGAGTAGCAGAGGCTGAGG - Intergenic
1088172899 11:107018067-107018089 AGCTGCAGCGGCCGAGGCGGTGG + Exonic
1088314988 11:108498332-108498354 AGCTGCAGCAGCAGGGCCCGCGG + Exonic
1088647011 11:111925679-111925701 TGCTGCAGCTGTTGTGGCTGCGG - Exonic
1088695327 11:112361424-112361446 TGCTGCCCCAGCTAAGGCTGGGG + Intergenic
1088797351 11:113274747-113274769 TCCTGCAACAGCACAGGGTGGGG + Intronic
1088925006 11:114293168-114293190 TGCTCCAGCAGCAGTGCCTGGGG + Intronic
1089065616 11:115659809-115659831 ACCTGCGGAAGCAGAGGCTGCGG + Intergenic
1089410150 11:118234313-118234335 TGCTGCAGCAGCAAAGAGTGAGG + Intronic
1089643922 11:119865548-119865570 GGCTCCCGCAGGAGAGGCTGAGG - Intergenic
1090099457 11:123778773-123778795 TCCTGCAGCTGCAGACTCTGTGG + Intergenic
1090107678 11:123869623-123869645 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1090235019 11:125140577-125140599 AGCAGCAGCAGCAGACGCCGAGG - Intergenic
1090403766 11:126465395-126465417 CGGGGCTGCAGCAGAGGCTGTGG - Intronic
1090872037 11:130757504-130757526 GGGTGCAGGAGCGGAGGCTGAGG + Intergenic
1090889901 11:130914664-130914686 ATCTGAAGGAGCAGAGGCTGAGG - Exonic
1090967630 11:131612892-131612914 AGCTCCTGCAGCAGAGGCAGAGG - Intronic
1091248916 11:134125112-134125134 GGCTGGAGCAGCAGTGGCGGCGG - Intronic
1091265333 11:134266435-134266457 TGCTGCAGGAGGACAGGGTGTGG + Intergenic
1091594328 12:1865621-1865643 TGGTGCAGCCGCAGCGGATGCGG - Intronic
1091886434 12:4020245-4020267 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1092075043 12:5665807-5665829 GGCTGGATCAGCTGAGGCTGTGG - Intronic
1092239062 12:6826600-6826622 TGCTGCAGGGACAGAGGCAGAGG - Intronic
1092265573 12:6977960-6977982 TGGTTCAGCAGCAGTGACTGAGG + Intronic
1092524350 12:9300728-9300750 AGCTCCAGGAGCAGAAGCTGGGG + Intergenic
1092542913 12:9431084-9431106 AGCTCCAGGAGCAGAAGCTGGGG - Intergenic
1092626823 12:10336926-10336948 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1092789630 12:12060112-12060134 GGGTGGAGGAGCAGAGGCTGAGG - Intronic
1093057231 12:14567629-14567651 AGCAGCAGCAGCAGAAGCGGTGG + Exonic
1093071240 12:14708867-14708889 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1093268088 12:17025696-17025718 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1093322063 12:17724298-17724320 AGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1093498084 12:19780056-19780078 TACTGTAGCTGCAGAGGCAGAGG + Intergenic
1093578737 12:20765091-20765113 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1093584597 12:20820999-20821021 GGGTGGAGGAGCAGAGGCTGAGG + Intronic
1094017865 12:25884147-25884169 TGCAGGAGCAGCAGTGGCAGAGG + Intergenic
1094142870 12:27198941-27198963 TACTGGAGCAACAGAGGCTCTGG - Intergenic
1094181602 12:27597602-27597624 TGCTGCTGGAGTAGAGGCGGAGG + Intronic
1094494874 12:30982973-30982995 TGTCACTGCAGCAGAGGCTGAGG - Intronic
1094635952 12:32227318-32227340 TGGGGCAGCATCAGAGGCTAGGG - Intronic
1095637577 12:44451484-44451506 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1096428911 12:51527290-51527312 TGCTGCAGCAGGAGATGGTCTGG + Intergenic
1096489440 12:52005910-52005932 GGCGTCAGCAGCACAGGCTGGGG - Intergenic
1096606328 12:52768981-52769003 AGCAGCAGCAGCAGTGGCTATGG - Exonic
1096613302 12:52817113-52817135 GGCTGCAGCTGCAGGAGCTGAGG + Intergenic
1096623425 12:52878824-52878846 GGCTGCCGCTGCAGAGGGTGGGG + Intergenic
1096673967 12:53216576-53216598 AGCTGGGGAAGCAGAGGCTGAGG + Intronic
1096841805 12:54384522-54384544 GGCTGCCGTAGCAGAGGCAGGGG + Exonic
1097398506 12:59103553-59103575 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1097417128 12:59327212-59327234 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1097542275 12:60956008-60956030 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1097592308 12:61588574-61588596 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1097879361 12:64672979-64673001 TGCTGCAGCAACCGAGGAGGAGG - Intronic
1098173718 12:67770645-67770667 GGGTGCAGGAGCGGAGGCTGAGG + Intergenic
1098402167 12:70087114-70087136 GGGTGCAGGAGCGGAGGCTGAGG - Intergenic
1098541558 12:71663468-71663490 AGCAGCAGCAGCAGCGGCGGCGG - Exonic
1098626529 12:72678000-72678022 GGCTAAAGCAGCAGAGGCTGGGG - Intergenic
1098628986 12:72705064-72705086 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1099188635 12:79541582-79541604 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1099292175 12:80787075-80787097 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1099762513 12:86940513-86940535 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1100561267 12:95750803-95750825 GGGTGGAGAAGCAGAGGCTGAGG - Intronic
1100940217 12:99716874-99716896 GGGTGGAGAAGCAGAGGCTGAGG - Intronic
1101544956 12:105703852-105703874 TGCTGCAGCAGAGAAGGCAGGGG + Intergenic
1101583818 12:106067224-106067246 TCCTCCGGCAGGAGAGGCTGTGG + Exonic
1102129703 12:110517216-110517238 TGCTGCAGCAGCTGAGGCAAGGG + Intronic
1102310733 12:111842522-111842544 GGCGGCAGCAGCAGCGGCGGAGG - Intronic
1102979748 12:117232020-117232042 TGCTGCAGCTGCAGAGGCGTTGG + Exonic
1102979786 12:117232200-117232222 TGCTCCTGGAGCAGAGGATGGGG + Intronic
1103308906 12:119989276-119989298 TGCTGCAGGGGCCGAGGCGGCGG - Intergenic
1103308908 12:119989282-119989304 TGCTGCTGCTGCAGGGGCCGAGG - Intergenic
1103308949 12:119989465-119989487 AGCAGCAGCAGCAGCGGCAGCGG + Intergenic
1103563397 12:121804068-121804090 AGCAGCAGCAGCAGCGGCGGCGG + Intergenic
1103649615 12:122422558-122422580 TGCAGCAGCAGCAGCCGCCGCGG + Exonic
1103713539 12:122929980-122930002 TGGTGCAGCGGCAGATGCTGGGG - Exonic
1103841635 12:123869919-123869941 TGCTGCAGCAGGAGAGGGGCAGG - Intronic
1104841619 12:131828558-131828580 AGCAGCAGCAGCAGCGGCAGCGG - Exonic
1104895011 12:132159740-132159762 GGCCGCAGCAGCAGAGGTCGGGG - Intergenic
1105217478 13:18297595-18297617 AGCAGCAGCAGCAGCGGCAGCGG + Intergenic
1105272805 13:18893949-18893971 ATCTGAAGGAGCAGAGGCTGAGG - Intergenic
1105477695 13:20742769-20742791 TGTTGCAACAAGAGAGGCTGAGG - Intronic
1105902752 13:24771233-24771255 TGCTTCAGCTGGAGAGGCTGAGG - Intronic
1105923615 13:24986975-24986997 TGCTGCTGCTGCAGTCGCTGAGG + Intergenic
1106138954 13:26994797-26994819 TGCGGCAGAAGCAGAGGCACTGG + Intergenic
1106189659 13:27440017-27440039 TCCAGGAGCGGCAGAGGCTGAGG - Exonic
1106720152 13:32428011-32428033 AGCAGCAGCAGCAGCGGCAGCGG - Exonic
1106796400 13:33210037-33210059 AGCTTCAACAGCAGACGCTGGGG + Intronic
1107075504 13:36318156-36318178 GGGTGGAGTAGCAGAGGCTGAGG - Intronic
1107133474 13:36920178-36920200 GGCTGCAGCAGCGGCGGCGGCGG + Exonic
1107220374 13:37973199-37973221 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1107683220 13:42871411-42871433 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1108202618 13:48058078-48058100 GGGTGGAGGAGCAGAGGCTGAGG - Intronic
1108446266 13:50511922-50511944 TGATGCAGCAGAAGAGACAGGGG + Intronic
1108494010 13:51006659-51006681 TGCTGGAGCCTCTGAGGCTGTGG + Intergenic
1108512915 13:51171581-51171603 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1108593154 13:51928243-51928265 TGCTCCAGGAACAAAGGCTGAGG + Intergenic
1108814051 13:54268571-54268593 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1108919622 13:55658972-55658994 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1108947358 13:56042026-56042048 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1108953024 13:56116416-56116438 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1109352833 13:61206475-61206497 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1109709738 13:66145335-66145357 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1109716825 13:66230372-66230394 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1109765212 13:66886410-66886432 AGCTGCAGCTGCAGACACTGAGG - Intronic
1111301971 13:86360122-86360144 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1111721832 13:91956034-91956056 GGTTGGAGCAGCAGTGGCTGGGG - Intronic
1112609848 13:100945627-100945649 GGCTGCAGCAGCCCAGGTTGAGG - Intergenic
1113200785 13:107866330-107866352 AGCAGCAGCAGCAGAGGCAGCGG - Exonic
1113322855 13:109253561-109253583 TGCTGCAGTAGTTGAGTCTGGGG + Intergenic
1113331503 13:109332499-109332521 TGCTGCATCAGCAAAGGGTGGGG - Intergenic
1113355212 13:109572596-109572618 TGCTGCAGTCGCAGAGCCTGTGG + Intergenic
1113914800 13:113863853-113863875 AGCAGCAGCAGCAGCAGCTGCGG + Exonic
1114302753 14:21393134-21393156 TCCTGCAGTAGCAGAAGCTCAGG + Exonic
1114519009 14:23321490-23321512 GGCAGCAGCAGCGGGGGCTGCGG + Exonic
1115240673 14:31249301-31249323 GGGTGCAGGAGCAGAGGCTGAGG + Intergenic
1115648138 14:35384344-35384366 AGGTGCGGCAGCAGTGGCTGTGG + Intergenic
1115956747 14:38789743-38789765 TGCTGGTGCACCAGAGGTTGGGG - Intergenic
1116179600 14:41517671-41517693 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1116353719 14:43900447-43900469 TGCTGCATCATCAGAGGATTAGG + Intergenic
1116490671 14:45499417-45499439 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1116534854 14:46016402-46016424 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1116952837 14:50894885-50894907 GGGTGGAGGAGCAGAGGCTGAGG - Intronic
1117609307 14:57465771-57465793 TGACACAACAGCAGAGGCTGTGG - Intergenic
1117801105 14:59445747-59445769 GGGTGGAGGAGCAGAGGCTGAGG - Intronic
1118012363 14:61622854-61622876 TGCAGCAGCAGCAGCAGCAGTGG + Intronic
1118425027 14:65651084-65651106 TGCTACAGCCACAGAGACTGTGG + Intronic
1118473343 14:66094643-66094665 TGCAGGAGCAGCAGTGGCTATGG - Intergenic
1118647255 14:67851768-67851790 TGCAGCAGCTGCAGTGGCAGAGG + Intronic
1118666527 14:68075894-68075916 TGCTGCAGCTGCAATGGCAGGGG + Intronic
1118937377 14:70300189-70300211 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1119317123 14:73705206-73705228 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1119468181 14:74876127-74876149 TGCTGCAGCCGCTGACTCTGGGG + Intergenic
1119608346 14:76040719-76040741 TGCTGCTGCAGCAGGGCTTGTGG - Intronic
1119665266 14:76480854-76480876 GCCTGTCGCAGCAGAGGCTGAGG + Intronic
1119739803 14:77007032-77007054 AGCTGCAGCAACTGAGGCAGGGG - Intergenic
1119865975 14:77974850-77974872 CACTGCAGCAGTAGAGGGTGAGG - Intergenic
1119867958 14:77989810-77989832 TGATGCAGCGACAGAGGCCGGGG - Intergenic
1120438133 14:84504204-84504226 GGGTGGAGGAGCAGAGGCTGGGG + Intergenic
1120439439 14:84517924-84517946 TCCTGCAGCAACAGAGCATGGGG + Intergenic
1120821233 14:88913570-88913592 GGATGCAGCAAAAGAGGCTGAGG + Intergenic
1120991855 14:90383927-90383949 CGTTGGAGCTGCAGAGGCTGCGG + Intergenic
1120999714 14:90442866-90442888 TGCTGCTCCATCTGAGGCTGGGG - Intergenic
1121598648 14:95186040-95186062 AGCTTCAGCAGCTGAGGCTGTGG + Exonic
1121611224 14:95282183-95282205 TTTTGCAGGAGCAGAGGATGGGG + Intronic
1121614405 14:95303496-95303518 GGGTGCAGCTGCAGAGGCAGAGG - Intronic
1122040919 14:98986914-98986936 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1122502583 14:102211086-102211108 TGGTGCAGCAGTAGAGAGTGAGG - Intronic
1122659079 14:103282404-103282426 TGCTGCAGCGGCTGTGACTGAGG - Intergenic
1122744847 14:103891549-103891571 TGTGGCAGGAGCTGAGGCTGGGG - Intergenic
1122819093 14:104332318-104332340 CTCAGCAGCAGCAGAGGCTGAGG - Intergenic
1122820532 14:104342601-104342623 TCTTGCTGCTGCAGAGGCTGAGG + Intergenic
1122891511 14:104734224-104734246 CCCTGCAGGAGCAGAGGGTGGGG + Intronic
1122919990 14:104876049-104876071 TGGGGCAGCAGCAGAGGGTGGGG + Intronic
1122975328 14:105168529-105168551 AGCGGCAGCGGCAGAGGCGGCGG + Exonic
1123642203 15:22408227-22408249 TGCAGGGGCTGCAGAGGCTGAGG + Intergenic
1123761853 15:23439698-23439720 GCCTGCAGGAGGAGAGGCTGGGG - Exonic
1123762158 15:23441443-23441465 TGCGGGAGCAGAAGAAGCTGCGG - Exonic
1124845996 15:33290459-33290481 GGCTGCAGCAGCAGGGCCTGAGG + Intergenic
1124957177 15:34367165-34367187 TGCTGCTGCAGCAGCGGCGGCGG + Exonic
1124957178 15:34367168-34367190 TGCTGCAGCAGCGGCGGCGGCGG + Exonic
1125131591 15:36289638-36289660 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1126206703 15:46053558-46053580 TGATGCAGATGCTGAGGCTGAGG - Intergenic
1126348080 15:47717508-47717530 TGCAGCAGCAGCAGCAGCAGCGG - Intronic
1126487609 15:49199502-49199524 TACTCCTTCAGCAGAGGCTGTGG - Intronic
1126963945 15:54030055-54030077 TGCTGCAGCAGCAGACAATAGGG - Intronic
1127932609 15:63606891-63606913 TGTGGCAGCAGCACAGGGTGAGG + Intergenic
1128159120 15:65411419-65411441 TGACTCAGGAGCAGAGGCTGTGG - Intronic
1128237199 15:66076532-66076554 TGCCACAGCAACAGAGGCAGTGG - Intronic
1128732552 15:70030998-70031020 AGCAGAAGCACCAGAGGCTGGGG + Intergenic
1128809934 15:70563395-70563417 TTCTGCAGCAGAAGGGGGTGAGG - Intergenic
1129029743 15:72609603-72609625 TCCTGAAACAGGAGAGGCTGCGG + Intergenic
1129029787 15:72609825-72609847 GGGAGCAGGAGCAGAGGCTGAGG + Intergenic
1129075245 15:72989363-72989385 TGCTGCAGTAGCATGGGGTGGGG + Intergenic
1129160743 15:73746425-73746447 AGCTGGAGCAGGAGAGGCTGGGG - Intronic
1129188530 15:73924747-73924769 AGCTGCTGCAGCAGAGGAGGGGG - Intergenic
1129385240 15:75192627-75192649 TGCTGGAGCAGAGGGGGCTGTGG + Intergenic
1129796926 15:78384863-78384885 TCCTGCAGCAGCCGAGACTGTGG + Intergenic
1129839473 15:78734874-78734896 AGGAGCAGCAGAAGAGGCTGGGG + Intergenic
1130259560 15:82344669-82344691 TGCGGGAGCTGGAGAGGCTGCGG - Exonic
1130259564 15:82344687-82344709 TGCGGGAGCTGGAGAGGCTGCGG - Exonic
1130259574 15:82344744-82344766 TCCTGGAGCAGGAGAGGCTTCGG - Exonic
1130261134 15:82355264-82355286 GGCGGCGGCAGCAGCGGCTGCGG - Intergenic
1130269108 15:82434442-82434464 TCCTGGAGCAGGAGAGGCTTCGG + Exonic
1130269118 15:82434499-82434521 TGCGGGAGCTGGAGAGGCTGCGG + Exonic
1130280101 15:82513754-82513776 GGCGGCGGCAGCAGCGGCTGCGG + Intergenic
1130281692 15:82524442-82524464 TCCTGGAGCAGGAGAGGCTTCGG + Intergenic
1130281702 15:82524499-82524521 TGCGGGAGCTGGAGAGGCTGCGG + Intergenic
1130471476 15:84229940-84229962 GGCGGCGGCAGCAGCGGCTGCGG + Intergenic
1130473061 15:84240604-84240626 TCCTGGAGCAGGAGAGGCTTCGG + Exonic
1130473070 15:84240661-84240683 TGCAGGAGCTGGAGAGGCTGCGG + Exonic
1130473074 15:84240679-84240701 TGCGGGAGCTGGAGAGGCTGCGG + Exonic
1130478970 15:84344511-84344533 GGCGGCGGCAGCAGCGGCTGCGG + Intergenic
1130480475 15:84354669-84354691 TCCTGGAGCAGGAGAGGCTTCGG + Intergenic
1130480484 15:84354726-84354748 TGCAGGAGCTGGAGAGGCTGCGG + Intergenic
1130480488 15:84354744-84354766 TGCGGGAGCTGGAGAGGCTGCGG + Intergenic
1130491224 15:84433015-84433037 TGCGGGAGCTGGAGAGGCTGCGG - Intergenic
1130491228 15:84433033-84433055 TGCAGGAGCTGGAGAGGCTGCGG - Intergenic
1130491236 15:84433090-84433112 TCCTGGAGCAGGAGAGGCTTCGG - Intergenic
1130492800 15:84443620-84443642 GGCGGCGGCAGCAGCGGCTGCGG - Intergenic
1130502807 15:84511815-84511837 TGCGGGAGCTGGAGAGGCTGCGG - Intergenic
1130502811 15:84511833-84511855 TGCAGGAGCTGGAGAGGCTGCGG - Intergenic
1130502819 15:84511890-84511912 TCCTGGAGCAGGAGAGGCTTCGG - Intergenic
1130593770 15:85234567-85234589 GGCGGCGGCAGCAGCGGCTGCGG + Intergenic
1130595350 15:85245212-85245234 TCCTGGAGCAGGAGAGGCTTCGG + Intergenic
1130595359 15:85245269-85245291 TGCAGGAGCTGGAGAGGCTGCGG + Intergenic
1130680291 15:85990585-85990607 TGGCCCAGCAGCAGTGGCTGGGG - Intergenic
1130855037 15:87832987-87833009 GGTTGGAGGAGCAGAGGCTGAGG - Intergenic
1130947554 15:88560471-88560493 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1131076289 15:89496750-89496772 AGCGGCAGGAGCAGAGGCTAAGG + Intergenic
1131261471 15:90890228-90890250 TGCAGGAGCAGCACAGGCGGGGG - Exonic
1131343932 15:91628635-91628657 TGTTGAAGCAGAAGAGCCTGAGG - Intergenic
1131447659 15:92513199-92513221 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1131493470 15:92882721-92882743 CGCTGCGGCGGCAGCGGCTGCGG - Intergenic
1131827144 15:96331055-96331077 AGCAGCAGCAGCAGCGGCTCCGG + Exonic
1132241702 15:100262403-100262425 TGTTTCAGCACCAGAGCCTGGGG - Exonic
1132246975 15:100305115-100305137 TGGTGCAGGAGCAGAGGGGGAGG + Intronic
1132262935 15:100441971-100441993 TGGTGGAGGAGCGGAGGCTGAGG - Intronic
1132340330 15:101074251-101074273 TGGTGGAGGAGCGGAGGCTGAGG - Intronic
1132468783 16:90227-90249 AGCTGCAGCAGCACAGGGTGGGG - Intronic
1132866281 16:2094159-2094181 CGCTGGCGCTGCAGAGGCTGGGG - Exonic
1132873054 16:2124133-2124155 AGCAGCAACAGCAGAGGGTGTGG + Intronic
1133265184 16:4579123-4579145 TTCTGCAGCAAAACAGGCTGGGG + Intronic
1133379465 16:5317983-5318005 TGCTGCTGCTGAAGAGGCAGGGG + Intergenic
1133676273 16:8075840-8075862 TGTGGCAGAAGCAGAGGGTGTGG - Intergenic
1133938097 16:10284843-10284865 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1134126661 16:11620846-11620868 TCCTGGAGCAGCAGCTGCTGAGG - Intronic
1134342256 16:13356563-13356585 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1134552142 16:15143312-15143334 AGCAGCAACAGCAGAGGGTGTGG + Intergenic
1134606977 16:15579014-15579036 AGTTGCTGCAGCTGAGGCTGGGG + Intronic
1135712554 16:24729916-24729938 GGCGGCGGCAGCAGAGGCGGCGG + Intronic
1135716750 16:24777106-24777128 TGCTGCTGCGGCTGCGGCTGTGG - Exonic
1136114563 16:28086699-28086721 CCCTGCAGCAGCACACGCTGGGG - Intergenic
1136220194 16:28823494-28823516 TGCTGCGGCGGCGGCGGCTGCGG - Exonic
1136500872 16:30669203-30669225 GGCGGCAGCAGCAGCGGCAGCGG - Exonic
1137300266 16:47143026-47143048 TGCTGCGGCCACGGAGGCTGCGG - Intronic
1137341075 16:47606080-47606102 TGCTGCTGCTGCAGAGGCAGCGG + Intronic
1137505811 16:49052867-49052889 TGCTGCAGCCAGAGAAGCTGTGG + Intergenic
1137581522 16:49636431-49636453 TGCTGCAGAATCACCGGCTGCGG - Exonic
1137687428 16:50396156-50396178 TGCTGCAGCTGCATACGCTCAGG - Intergenic
1137786515 16:51141737-51141759 AGCAGCAGCAGCAGCGGCGGCGG - Exonic
1137821325 16:51448894-51448916 AGCTGCAACAGCAGAAGGTGAGG - Intergenic
1138004944 16:53324525-53324547 TAATGCAGCAGTAGAGGATGTGG - Exonic
1138759184 16:59521636-59521658 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1138804870 16:60080548-60080570 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1138922969 16:61555715-61555737 AGCTGCAGCTGCTGATGCTGGGG - Intergenic
1139039311 16:62983165-62983187 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1139152963 16:64406716-64406738 AGATGAAGAAGCAGAGGCTGAGG + Intergenic
1139433907 16:66925492-66925514 GGCTGCAGCAGCAGCGGCGGCGG - Exonic
1139801100 16:69523628-69523650 TGCAGCAGCGGGAGAGTCTGAGG + Intergenic
1139854527 16:69969863-69969885 TTCTGTGCCAGCAGAGGCTGTGG - Intergenic
1139883507 16:70192778-70192800 TTCTGTGCCAGCAGAGGCTGTGG - Intergenic
1140369003 16:74402741-74402763 TTCTGTGCCAGCAGAGGCTGTGG + Intergenic
1141141181 16:81497798-81497820 TGCAGCAGCAGAGGAGGCGGCGG - Intronic
1141141182 16:81497801-81497823 GGCTGCAGCAGCAGAGGAGGCGG - Intronic
1141413341 16:83851492-83851514 TGCTGAAGGAGCTGTGGCTGAGG - Intergenic
1141546534 16:84773806-84773828 AGATGCAGGAGCAGAGGCCGAGG - Intronic
1141944935 16:87303433-87303455 TGCTACAGCAGCCGGGGGTGGGG - Intronic
1141974506 16:87506432-87506454 ACCTGCAGCAGAGGAGGCTGAGG - Intergenic
1142408506 16:89904302-89904324 TCCAGCAGCAGGAGGGGCTGTGG + Intronic
1203144838 16_KI270728v1_random:1792937-1792959 ATGTGCAGCAGCCGAGGCTGGGG + Intergenic
1142542755 17:673434-673456 CTCAACAGCAGCAGAGGCTGCGG + Intronic
1142757642 17:2025242-2025264 TGCTGCAGCCGCGGCGGCGGTGG - Exonic
1143186244 17:5012245-5012267 TCCTTCTGCAGCAGAGGCAGGGG + Intronic
1143519705 17:7438309-7438331 GGCGGCAGCGGCAGCGGCTGTGG - Intronic
1143592300 17:7892906-7892928 TGTGGCAGCACCTGAGGCTGAGG - Intronic
1143639548 17:8188337-8188359 TGCTGCTGCTGCGAAGGCTGAGG - Exonic
1144509843 17:15866692-15866714 AGCGGCAGCGGCAGAGGCAGAGG - Intergenic
1144509846 17:15866710-15866732 AGCGGCAGCGGCAGAGGCAGCGG - Intergenic
1144930915 17:18858212-18858234 TCCTTCTGCAGCTGAGGCTGCGG + Exonic
1145173951 17:20684329-20684351 AGCGGCAGCGGCAGAGGCAGAGG - Intergenic
1145217344 17:21061854-21061876 TGCAGGAGCAGCAGTGGCAGTGG - Intergenic
1145750016 17:27349085-27349107 TGCTGGAGCAGCAGTGGCGGCGG + Intergenic
1145826204 17:27878936-27878958 CGCTGCAGGAGCAGAGGAGGGGG + Exonic
1145959667 17:28880034-28880056 GGCAGCAGCAGGTGAGGCTGTGG + Exonic
1146358931 17:32158950-32158972 TGCTGGAGCAGCAGTGGTGGTGG + Intronic
1146570871 17:33951508-33951530 TGATGGAGCAGCAGACACTGTGG + Intronic
1146597821 17:34184990-34185012 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1146638625 17:34524076-34524098 ATCTGCAGAAGCAAAGGCTGTGG - Intergenic
1146838933 17:36136048-36136070 GGGTGAACCAGCAGAGGCTGTGG + Intergenic
1147188313 17:38724855-38724877 TGCTGCAGCTGCAGCTGCTGCGG - Exonic
1147393182 17:40122361-40122383 GGCGGCGGCAGCAGAGGCGGCGG + Intronic
1147400414 17:40177545-40177567 CGCTGCGGCGGCAGAGGCAGCGG - Intronic
1147456004 17:40538571-40538593 CTCTGCAGCACTAGAGGCTGTGG + Intergenic
1147585648 17:41652760-41652782 GGCTGTGGGAGCAGAGGCTGAGG - Intergenic
1147873093 17:43601556-43601578 TCCTGCAGCAGCTCAGGCTCAGG - Intergenic
1147948435 17:44093399-44093421 AGCTGGAGCAGCAGCGGCAGCGG - Exonic
1147996430 17:44362659-44362681 TCCTGCAGCAGGAAAGGGTGGGG - Intronic
1148079717 17:44960938-44960960 TGCTGCAGCAGGAGAGACTCTGG - Intronic
1148218310 17:45845867-45845889 GCCAGCAGCAGCAGAGGCAGCGG - Exonic
1148555413 17:48576221-48576243 AGCGGCAGTAGCAGAGGCGGAGG + Exonic
1148835758 17:50464941-50464963 CTGTGCATCAGCAGAGGCTGTGG + Exonic
1148853893 17:50568120-50568142 TGCTACAGCACCAGAGCCCGGGG - Intronic
1148878537 17:50707610-50707632 AGGAGCAGCAGGAGAGGCTGCGG - Exonic
1149078211 17:52622469-52622491 TGTTGCAGAAGCAGAATCTGTGG + Intergenic
1149127382 17:53252154-53252176 TGCTACAACAGCAGAGTTTGTGG + Intergenic
1149468955 17:56900887-56900909 GGCTGCAGCGGCAGATGCAGAGG + Intronic
1149525563 17:57352845-57352867 GGCTGAAGCAGCAGAGGAGGAGG - Intronic
1149549942 17:57532737-57532759 TGCTGCAGTGGCAGAAGTTGAGG + Intronic
1150186083 17:63182560-63182582 TCCTGAAGAAGCAGAAGCTGAGG + Intronic
1151229902 17:72677105-72677127 AGCAGCAGCCGCAGTGGCTGAGG + Intronic
1151329019 17:73395880-73395902 AAATGCAGCAGGAGAGGCTGAGG - Intronic
1151622408 17:75254263-75254285 GGGTGGAGGAGCAGAGGCTGAGG - Intronic
1152065503 17:78110512-78110534 TGCAGCTGCTCCAGAGGCTGAGG - Exonic
1152366956 17:79861933-79861955 TTAGGCAGCAGCAGGGGCTGGGG + Intergenic
1152432876 17:80259642-80259664 TGGTGCACCTGAAGAGGCTGAGG - Intergenic
1152437560 17:80285638-80285660 AGCTGCAGAAGAAGAGTCTGGGG - Intronic
1152458936 17:80431330-80431352 GGCTGCAGGGGCAGAGGCTCTGG + Intronic
1152586765 17:81192789-81192811 CGCTGCAGCAGCAACGGCAGCGG - Exonic
1152941745 17:83176442-83176464 AGCAGCAGCAGCGGAGGCTGGGG + Intergenic
1153740069 18:8115420-8115442 TGCTTCTGCAGGAGATGCTGGGG - Intronic
1154316118 18:13304502-13304524 TGCTGTCGCAGCACAGGCTGTGG + Intronic
1155191938 18:23437921-23437943 CGCAGCAGCAGCAGCGGCAGCGG + Intronic
1155403988 18:25467739-25467761 GGCTCCAGCAGCCCAGGCTGTGG - Intergenic
1155420200 18:25647674-25647696 AACTGCAGCAGCAGAGGCTGTGG - Intergenic
1155708605 18:28847531-28847553 CACTGCAGCAGCAGTGGCAGAGG - Intergenic
1156171758 18:34494057-34494079 CGCGGCAGCAGCAGGGGCTGCGG - Intronic
1156237274 18:35217455-35217477 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1156452180 18:37273153-37273175 TGCTGCATCAGCTGGGGCAGAGG + Exonic
1156543153 18:37937117-37937139 TGCTGAAGCAACAAAGGCTACGG - Intergenic
1156756877 18:40538382-40538404 TGCAGCAGCAGCAGCAGCAGTGG - Intergenic
1157577124 18:48750754-48750776 TGGTGCAGAAGCAAAGGCGGAGG - Intronic
1158336301 18:56417307-56417329 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1158394719 18:57070623-57070645 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1158606598 18:58901469-58901491 TGGTTCAGAAGTAGAGGCTGTGG + Intronic
1158648927 18:59269526-59269548 TCGGGCAGCAGCGGAGGCTGCGG + Intronic
1158920591 18:62187301-62187323 TGCTGGTGCAGCAGAGGCTGAGG + Exonic
1158976508 18:62715767-62715789 TGCGGCAGCAGCAGCAGCAGCGG + Exonic
1159072481 18:63641217-63641239 GGCAGAAGCAGAAGAGGCTGTGG + Intronic
1159073924 18:63658856-63658878 GGCAGAAGCAGAAGAGGCTGTGG + Intronic
1159235298 18:65663685-65663707 TGCTGTACCAACAGAGGGTGAGG + Intergenic
1159481143 18:68992682-68992704 AGCTCCAGGGGCAGAGGCTGGGG + Intronic
1160337920 18:78059374-78059396 TGCTGAAGCCGCACCGGCTGTGG - Intergenic
1160382547 18:78471688-78471710 TGCTCCAGCAGCAGACGGGGAGG - Intergenic
1160441481 18:78896162-78896184 TGCTGCTGCTGCTGCGGCTGAGG - Intergenic
1160581772 18:79887299-79887321 TGCTGAGACAGCAGAGGCGGAGG + Intronic
1161176629 19:2846679-2846701 TGCTGCAGAAGCAAAGCCTTCGG - Intronic
1161235650 19:3196784-3196806 TGCTGCAGCAGCAGCGACACAGG - Intronic
1161235654 19:3196794-3196816 TGCTGCTGCAGCACTGGCAGGGG + Intronic
1161252151 19:3285992-3286014 TGCTGCTGCAGGAGGGGCGGCGG - Exonic
1161661640 19:5550187-5550209 GGATGCAGGAGCAGAGGCTGAGG - Intergenic
1161711132 19:5848765-5848787 GGGTGGAGGAGCAGAGGCTGAGG - Intronic
1161749027 19:6080694-6080716 TCTTGCAGCAGCAGAGGCCCTGG + Intronic
1161960488 19:7520459-7520481 TGCTGCAGCTGCAGCGGCCGCGG - Exonic
1162019097 19:7860607-7860629 AGCTGGAGCAGTCGAGGCTGCGG + Exonic
1162110807 19:8398637-8398659 TGCTGCACCAGGAGAGGTGGGGG + Intronic
1162311991 19:9913411-9913433 TGCGGCGGCGGCAGCGGCTGTGG + Intronic
1162315558 19:9936326-9936348 AGCAGCAGCAGCAGCGGCGGCGG + Exonic
1163127266 19:15251086-15251108 TGCTGCTGGGGCAGAGGGTGGGG + Intronic
1163211603 19:15845044-15845066 TGCTCCAGGAGCAGAGGGAGAGG + Intergenic
1163454649 19:17399331-17399353 TGGAGCAGCAGCATAGTCTGGGG + Intergenic
1163668235 19:18612980-18613002 AGCAGCAGCAGCAGCGGCGGTGG - Exonic
1163843132 19:19623796-19623818 TTCTTTAGCAGCAGAGACTGAGG - Exonic
1163847548 19:19646118-19646140 GACTTCAGCAGGAGAGGCTGGGG - Intronic
1164057634 19:21635187-21635209 GGCGGCAGCAGCAGTGGCCGAGG - Intergenic
1164061566 19:21679734-21679756 TGCTGGAGCAGCTCAGGGTGAGG + Intergenic
1164559113 19:29276425-29276447 TACTGCAGCAGCAAGGCCTGTGG + Intergenic
1164711278 19:30358830-30358852 GGCTGAAGCAGCTCAGGCTGGGG + Intronic
1164938481 19:32232924-32232946 GGCTTGAGCAGGAGAGGCTGAGG - Intergenic
1164982650 19:32625950-32625972 TAGTGCAGCAGCAGCAGCTGCGG + Exonic
1165072036 19:33261291-33261313 TGCCAGAGAAGCAGAGGCTGAGG - Intergenic
1165510389 19:36263477-36263499 GGATGGAGGAGCAGAGGCTGAGG + Intergenic
1165790066 19:38486019-38486041 TGCTGGGGCAGCAGAGGCCCCGG + Exonic
1165822680 19:38686517-38686539 TAGGGCAGCAGCAGAGGCTGGGG - Intronic
1166140154 19:40801026-40801048 TGCAGCTGCAGCAGTGGCAGTGG + Exonic
1166731908 19:45064125-45064147 TGCTGCGGCAGCAGCGGCTGCGG - Exonic
1166748338 19:45152508-45152530 TGCAGCAGCAGCAGCAGCAGGGG - Exonic
1166888033 19:45973374-45973396 TGCTGCTGCTGCGGCGGCTGCGG + Exonic
1167043371 19:47036022-47036044 TGCTGGAGCAACTGGGGCTGCGG + Exonic
1167571604 19:50292379-50292401 GGCTGCAGGAGGTGAGGCTGGGG + Exonic
1167661037 19:50796354-50796376 TCATGCAGCAGCAGGCGCTGTGG + Intergenic
1167709890 19:51104134-51104156 AGGTGCAGCAGGAGCGGCTGCGG + Exonic
1167771891 19:51525865-51525887 GGCTGCAGCAGCAATGGCAGAGG - Intronic
1167907199 19:52671525-52671547 TGCTTGAGCACCAGAGGTTGAGG - Intronic
1168640196 19:58025998-58026020 TGCTGTAGCTGCAGAGGCTATGG + Intergenic
1168672098 19:58248356-58248378 TGCTGTGGCACCTGAGGCTGGGG - Intronic
1168686353 19:58351657-58351679 TGGTGCATCAGCACAGGCGGTGG + Exonic
1202704596 1_KI270713v1_random:13668-13690 AGCTGGAGCAGCAGCAGCTGAGG - Intergenic
1202710875 1_KI270714v1_random:18837-18859 TGCGGCAGCTGCTGAGGCAGCGG - Intergenic
925191954 2:1892246-1892268 TGCTGCTGCTGCTGGGGCTGGGG + Exonic
925544476 2:5002696-5002718 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
925671017 2:6310024-6310046 AGCTGGGGCAGCTGAGGCTGTGG + Intergenic
925984832 2:9207042-9207064 TGCTGCGGCAGTTGAGGCGGCGG + Exonic
926071493 2:9897021-9897043 TGAAGCAGCAGAAGAGGCAGAGG - Intronic
926169918 2:10546545-10546567 GGCTGCAACAGCAAAGGCTGTGG - Intergenic
926407695 2:12571474-12571496 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
926413516 2:12628218-12628240 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
926464167 2:13167983-13168005 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
926541044 2:14182337-14182359 TGCGGGAGCAGCAGTGGCAGTGG + Intergenic
926815627 2:16795935-16795957 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
927400344 2:22703699-22703721 AGCAGCAGCAGCAGTGGCAGTGG - Intergenic
927506995 2:23621181-23621203 AGCAGCAGCAGCAGCAGCTGAGG + Intronic
927559404 2:24059324-24059346 GGCTTCTGAAGCAGAGGCTGGGG + Intronic
927708260 2:25310354-25310376 TGTTGCCGCAGCAGAGGGAGGGG - Intronic
927726447 2:25427467-25427489 GGAGGCAGCAGCTGAGGCTGTGG + Intronic
927786543 2:25978980-25979002 TGCTGCTGCAGCAGGGGCTCTGG - Intronic
927881532 2:26693000-26693022 AGCTGCGGCAGCAGGAGCTGCGG + Exonic
927957390 2:27217365-27217387 GGCGGCAGCAGCAGAGACTGCGG - Intergenic
928376148 2:30776345-30776367 TGGTGCAGCTGTGGAGGCTGTGG - Intronic
928779758 2:34804887-34804909 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
929615245 2:43301592-43301614 TGCTGCAGTAGCTTATGCTGAGG - Intronic
930011490 2:46941265-46941287 AGCTGCTACAGCAGAGGCGGAGG + Exonic
930186331 2:48415577-48415599 TGCTGGAGCAGCTGATGCTCAGG + Intergenic
930487447 2:52026143-52026165 GGGTGGAGGAGCAGAGGCTGGGG + Intergenic
930728739 2:54708632-54708654 TGCAGGAGCAGCAGTGGCGGTGG + Intergenic
931026470 2:58117406-58117428 GGGTGGAGGAGCAGAGGCTGAGG + Intronic
931279858 2:60780714-60780736 TGCTTCAGCAGCACAGGATTTGG - Exonic
931643466 2:64401195-64401217 TCCTTCAGCACCAGTGGCTGTGG + Intergenic
931695719 2:64869204-64869226 TGAGGCAGCAGCAGAGGGTGAGG + Intergenic
931948178 2:67333293-67333315 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
932295776 2:70622335-70622357 GGGTGGAGGAGCAGAGGCTGAGG - Intronic
932358895 2:71089038-71089060 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
932436348 2:71704509-71704531 TGGTGAGGCAGCTGAGGCTGAGG + Intergenic
932494262 2:72138721-72138743 TGCTGCAGCCCCAGAGGCTCAGG + Intronic
932974028 2:76577846-76577868 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
933163655 2:79053103-79053125 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
933179846 2:79215839-79215861 GGGTGGAGGAGCAGAGGCTGAGG + Intronic
933329597 2:80878459-80878481 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
934058259 2:88270542-88270564 TGAGGAAGCAGCAGATGCTGAGG - Intergenic
934196557 2:89841718-89841740 TGGTGCAGTAGCAGAGGAAGTGG - Intergenic
934296827 2:91749056-91749078 AGCAGCAGCAGCAGCGGCAGCGG - Intergenic
934818729 2:97353566-97353588 TGGTTCAGCAGCAGAGGAAGTGG - Intergenic
935148377 2:100412112-100412134 TTCTTCAGCAGCAGAGTCAGAGG + Intronic
935154836 2:100474989-100475011 CTCTGCACCAGCAGAGGCAGTGG + Intronic
935314256 2:101815999-101816021 GACTGCAGCTGCAGCGGCTGTGG + Intronic
935583078 2:104775769-104775791 TTCTGAAGCAGCAGAAGCAGTGG + Intergenic
935586535 2:104804657-104804679 TGCTCCATCACCTGAGGCTGTGG - Intergenic
935669981 2:105546794-105546816 AGCTGCTGAAGCAGAGGCAGGGG + Intergenic
935943429 2:108265190-108265212 TGCTGCAGGAGTAGAGGGAGAGG - Intronic
936392510 2:112087979-112088001 GGGTGCAGCAGAGGAGGCTGGGG - Intronic
936493147 2:112993092-112993114 TCCTTTGGCAGCAGAGGCTGAGG + Intergenic
937076954 2:119114061-119114083 TGCACCAGCAGCAGGGGCTACGG - Intergenic
937115546 2:119402619-119402641 ACCTGCAGCATCAGAGGCTCTGG + Intergenic
937138286 2:119574651-119574673 GGCTGCTGCAGCAGAAGCAGTGG - Intronic
937140684 2:119597335-119597357 CTGGGCAGCAGCAGAGGCTGGGG + Intronic
937224159 2:120358638-120358660 TGCTGGAGCAACTGAGGCTGAGG + Intergenic
937305092 2:120866152-120866174 TCCTGCAGAAGCACAGGCTGAGG - Intronic
937428398 2:121818165-121818187 AGCTGCAGCCCCAGAGGCAGAGG - Intergenic
937604492 2:123781184-123781206 TCCGGCAGCAGCAGAGGATAAGG + Intergenic
937862477 2:126721894-126721916 TGCTTCAGCAGGAGGGGATGAGG + Intergenic
938199595 2:129362084-129362106 GCCTGGAGGAGCAGAGGCTGTGG - Intergenic
940265107 2:151828267-151828289 GGGAGCAGCAGCAGAGGCGGAGG - Exonic
940530112 2:154869038-154869060 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
940931007 2:159430936-159430958 GGCAGCAGGAGCAGAGCCTGGGG + Exonic
940956201 2:159731003-159731025 AGCTGCTGGAGGAGAGGCTGAGG - Intronic
941018866 2:160387215-160387237 AGCTGCAGCAGCTGGGGATGCGG + Intronic
941120191 2:161520991-161521013 TGCTGCAGCCCAGGAGGCTGAGG - Intronic
941572776 2:167192676-167192698 TGCCGCAGAAGCAGAGGTGGTGG - Intronic
941935975 2:170981655-170981677 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
942097005 2:172543427-172543449 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
942446198 2:176080430-176080452 CGCGGCAGCCGCAGCGGCTGCGG - Exonic
942459652 2:176160244-176160266 CCGTGGAGCAGCAGAGGCTGAGG - Intronic
943049903 2:182901846-182901868 TGCTGCAGAGGCAGGGCCTGTGG - Intergenic
943129678 2:183840005-183840027 TGCTGCAGCTGCAGCTGCTGTGG - Intergenic
943413009 2:187564472-187564494 GGGTGGAGGAGCAGAGGCTGAGG + Intronic
943421660 2:187674467-187674489 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
943461273 2:188173225-188173247 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
943835068 2:192507739-192507761 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
944080977 2:195787985-195788007 TGCTGGAGAACCAGAAGCTGAGG + Intronic
944284270 2:197930974-197930996 TGCTGAATGAGCAGGGGCTGTGG + Intronic
944394057 2:199248642-199248664 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
944471303 2:200055932-200055954 CACTGCAGCAGCAGTGGCAGAGG - Intergenic
945019574 2:205557442-205557464 AGCTGCAGGAGCAGAAGTTGAGG - Intronic
945182423 2:207105499-207105521 TGCTGCAGGAGAACAGGCTTTGG - Intronic
945301564 2:208220265-208220287 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
945361565 2:208900936-208900958 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
946400670 2:219466768-219466790 TGGTGCAGGAGCAGGGGCAGGGG + Intronic
946721673 2:222615481-222615503 TGCGGAAGCAGCAGGGGTTGAGG - Intronic
947157249 2:227174981-227175003 TGGTGCTGCAGGAGAGGATGGGG + Intronic
947461631 2:230308774-230308796 ACCTGCAGCAGCAGAGCCGGCGG + Intronic
947523397 2:230864978-230865000 GGCTGCACCGGCAGAGGCTGCGG + Exonic
948060953 2:235042985-235043007 TGCTGCTGGAGCAGATCCTGCGG + Exonic
948195161 2:236090167-236090189 GGCTCCAGCTGCACAGGCTGGGG + Intronic
948230029 2:236342677-236342699 TGCTGCAGCAGGAGAGGAGCGGG - Intronic
948338422 2:237229855-237229877 TGCTGCAACCGCAGAGGCTAGGG + Intergenic
948390607 2:237608672-237608694 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
948483800 2:238267433-238267455 GGCAGCAGGAGCAGAGACTGTGG + Intronic
948501420 2:238397664-238397686 TGCAGCAGGAGCAGAGGTGGGGG + Exonic
948501436 2:238397708-238397730 TGCAGCAGGAGCAGAGGTGGGGG + Intronic
948501452 2:238397752-238397774 TGCAGCAGGAGCAGAGGTGGGGG + Intronic
948501593 2:238398197-238398219 TGCAGCAGGAGCAGAGGTTAAGG + Intronic
948501650 2:238398364-238398386 TGCAGCAGGAGCAGAGGTAGGGG + Intronic
948624466 2:239260659-239260681 GGCTGCAGGAGCAGAGCCGGAGG - Intronic
948666415 2:239537296-239537318 GGCTGCAGCAGCAAAGGAAGGGG + Intergenic
948815782 2:240509875-240509897 TGCTCCACCAGCCGAGGGTGGGG - Intronic
948820403 2:240540658-240540680 TGCTGCAGCGGAGGAGACTGGGG - Intronic
948831512 2:240600614-240600636 CCCTCCAGCAGCAGTGGCTGTGG + Intronic
948886412 2:240887326-240887348 TCAGGGAGCAGCAGAGGCTGGGG - Intronic
949055416 2:241925554-241925576 TGGTCCAGCAGCAGGGGCTGTGG - Intergenic
1168739266 20:174224-174246 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1168949793 20:1789261-1789283 GGCTGCAGCAGCTGGGGGTGGGG + Intergenic
1168963896 20:1887309-1887331 AGCTGCAGCAGCAAAGACAGTGG + Intergenic
1169041396 20:2498377-2498399 TGGTGCTGAAGAAGAGGCTGAGG + Intronic
1169317226 20:4602678-4602700 AGCTGCAGCAGCAGCGCCTCAGG + Intergenic
1169328769 20:4699562-4699584 TGCTGCAGCAGCTGGGGCAGTGG + Exonic
1169934073 20:10864492-10864514 TGCTGCACCAGCAATGCCTGGGG - Intergenic
1170629730 20:18056805-18056827 GGCGGCAGCAGCAGCGGCAGCGG - Exonic
1170971126 20:21117508-21117530 TGCTGCAGGAGTGGAAGCTGGGG - Intergenic
1171376616 20:24698342-24698364 TGCAGCAGCAGCTGTGGATGTGG - Intergenic
1171891991 20:30725177-30725199 TTCTGCAGCAGCTGAGGCGCTGG + Intergenic
1172095064 20:32456545-32456567 GGCTGCCTCAGCTGAGGCTGTGG - Intronic
1172187079 20:33037556-33037578 TGCTGCTGCACCACAGGCTATGG - Exonic
1172229973 20:33330057-33330079 TCCTGCAGAAGAAGAAGCTGAGG + Intergenic
1172413406 20:34743173-34743195 TGCTGCTGCTGCTGAGACTGTGG + Exonic
1172684893 20:36746070-36746092 TGCAGCAGCAGCGGCGGCGGCGG + Exonic
1172887460 20:38240832-38240854 TGCAGCTGCAGGAGAAGCTGGGG + Exonic
1172937314 20:38629494-38629516 CCCCGCAGCAGCAGAGCCTGGGG + Exonic
1173307426 20:41863496-41863518 TGCTACAGCAGCAGAGGTGGGGG + Intergenic
1173307522 20:41864165-41864187 TGCTACAGCAGCAGAGCTGGGGG - Intergenic
1173564167 20:44027472-44027494 TTCTGCAGCTGCACAGGCTATGG - Intronic
1174025277 20:47569065-47569087 TGCCTCAGCATGAGAGGCTGTGG - Intronic
1174053922 20:47785462-47785484 TGCAGCAGCGGCAGCGGCGGCGG - Intronic
1174417450 20:50376919-50376941 AGATGCAGCCGCAGGGGCTGTGG + Intergenic
1175037624 20:56015173-56015195 TGGTGCTGCAGCAGGAGCTGGGG + Intergenic
1175094019 20:56527653-56527675 TGCTGCAGCCGCAGAAGCCATGG - Intergenic
1175176578 20:57115952-57115974 GGCTGCAGCAGTGGAGACTGGGG + Intergenic
1175179881 20:57138412-57138434 TGCCTCTGAAGCAGAGGCTGTGG - Intergenic
1175794410 20:61762707-61762729 TTCTGTAGCTGCAGAGCCTGGGG - Intronic
1175796743 20:61776016-61776038 TCCTGCAGCATCAGTGGCTGAGG + Intronic
1175888959 20:62307655-62307677 TGCTGGAGCAGAAGGGGCTGGGG - Exonic
1176016219 20:62934545-62934567 TGCAGCAGCAGGTGAGACTGAGG - Intronic
1176128712 20:63487306-63487328 TGCTGCAGCATGACTGGCTGTGG + Intergenic
1176267780 20:64219790-64219812 TGCTGCAGCTGCTGCTGCTGGGG - Exonic
1176298824 21:5088854-5088876 TGCTGCAGAAACGGAGGCAGAGG - Intergenic
1176625189 21:9086797-9086819 TTCTGCAGCAGCTGAGGCGCTGG - Intergenic
1176845631 21:13874443-13874465 TGCTGCAGAGGCAGAGGCTCAGG - Intergenic
1177102601 21:16915676-16915698 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1177310218 21:19381918-19381940 TGGTGCAGCAGCTGAGACTTTGG - Intergenic
1177698635 21:24607975-24607997 AGCTTCAACAGCAGAGACTGTGG + Intergenic
1177840826 21:26232061-26232083 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1178316570 21:31571346-31571368 CCCTGCAGCTGGAGAGGCTGGGG + Intergenic
1178890718 21:36519081-36519103 TTCTGCAGCTGCAGTGGGTGAGG - Intronic
1179251219 21:39673334-39673356 TGGTGCAGCTTCAGAGGATGAGG + Intergenic
1179387476 21:40956666-40956688 GGGTGGAGGAGCAGAGGCTGTGG - Intergenic
1179398290 21:41060952-41060974 GGGTACAGCAGCAGAGGGTGAGG - Intergenic
1179622277 21:42625108-42625130 TGCTGTACCAGCAGAGTCAGGGG + Intergenic
1179858202 21:44173095-44173117 TGCTGCAGAAACGGAGGCAGAGG + Intergenic
1180702791 22:17790801-17790823 TGCTGGAGGAGCAGCGGCTCCGG - Exonic
1180722334 22:17918756-17918778 AGCTGCAGATGCGGAGGCTGAGG - Intronic
1180740851 22:18052398-18052420 GGCAGCAGCAGCAGAGGCACCGG + Intergenic
1181493941 22:23277503-23277525 AGCAGCAGCAGCAGGGGATGGGG - Intronic
1181564682 22:23728217-23728239 TGCAGCAGAAACAGATGCTGGGG - Intergenic
1182143000 22:27978880-27978902 TGATGGAGTAGCAGAGGGTGGGG + Exonic
1182212665 22:28689810-28689832 TGCTGCAGGAGCAGGAGATGAGG + Intronic
1182421221 22:30249398-30249420 TGCAGGAGCAGGACAGGCTGTGG - Intergenic
1182732200 22:32504506-32504528 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1182794787 22:32984044-32984066 AGCTGAGGCAGGAGAGGCTGAGG + Intronic
1183123089 22:35746496-35746518 GGCTGCAGCAGCGGTGGCTGCGG + Exonic
1183349065 22:37324727-37324749 AGCTGCAGCCGGAGGGGCTGGGG - Intergenic
1183722377 22:39570085-39570107 TGCTGCAGAATCAGAGACTGGGG - Intergenic
1183736016 22:39645392-39645414 GGCAGCAGCTGCAGAGGCAGGGG + Intronic
1183759948 22:39806959-39806981 AGCTGGAACATCAGAGGCTGGGG + Intronic
1183920779 22:41165883-41165905 GGCTGAGGCAGGAGAGGCTGAGG - Intronic
1184726143 22:46347798-46347820 AGCAGAAGCAGCAGGGGCTGGGG - Intronic
1184846428 22:47090596-47090618 CGCTGAGGAAGCAGAGGCTGTGG - Intronic
1184866159 22:47202779-47202801 TGCAGGAGCAGCAGTGGCAGCGG - Intergenic
1184879673 22:47296979-47297001 TGCTGCTGCAGCACTGGGTGTGG - Intergenic
1185083657 22:48724049-48724071 TGCTGCAGCAGGAGAGACTCGGG + Intronic
1185083661 22:48724085-48724107 TGCTGCAGCAGGAGAGACTCAGG + Intronic
1185083665 22:48724121-48724143 TGCTGCAGTAGGAGAGACTTGGG + Intronic
1185083672 22:48724194-48724216 TGCTGCAGCAGGAGAGACTCAGG + Intronic
1185118307 22:48950517-48950539 TGTTGCAAGAGCAGAGACTGTGG + Intergenic
1185216190 22:49601221-49601243 GGCTGAGGCAGGAGAGGCTGAGG + Intronic
1185276955 22:49953963-49953985 TGCAGCAGGAGCAGAGGACGGGG - Intergenic
949287978 3:2429367-2429389 AGTGTCAGCAGCAGAGGCTGCGG + Intronic
949813231 3:8030692-8030714 TTCTACAGAAGCAGATGCTGAGG + Intergenic
950105404 3:10385313-10385335 CCCTGCAGCAGCAGACGGTGCGG - Exonic
950347324 3:12308441-12308463 TGCTGCAGAGGCAGAGACCGTGG + Intronic
950375647 3:12570092-12570114 TGCTGCAGCTGGAGGTGCTGTGG + Exonic
950428193 3:12935939-12935961 AGCGGCAGGAGCAGCGGCTGCGG - Exonic
950441254 3:13012017-13012039 TGAGGCACCACCAGAGGCTGCGG + Intronic
950452221 3:13071911-13071933 TGCTGACGCAGCAGAGGCAGAGG + Intronic
950455693 3:13091567-13091589 TACTGCAGGAGCAGGGGCTGGGG + Intergenic
950671833 3:14532014-14532036 AGCTGGAGCCGCAGAGGTTGGGG - Intronic
950717727 3:14861748-14861770 AGCAGCAGCAGCAGGAGCTGAGG + Intronic
950926418 3:16746033-16746055 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
951298891 3:20971516-20971538 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
951718668 3:25674798-25674820 TGCAGGAGCAGCAGTGGCAGTGG - Intergenic
952613470 3:35240294-35240316 TGGGGCAGCAGCAGGGGCAGTGG + Intergenic
952616139 3:35276339-35276361 GTCAGCAGCAGCAGTGGCTGTGG - Intergenic
952663536 3:35878349-35878371 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
952877028 3:37954695-37954717 TGCTTCTGCAGCAGCGGCTTGGG + Intronic
952919042 3:38272077-38272099 TTGTGCAGCAGCAGAGACTGAGG - Intronic
953351314 3:42218427-42218449 TGCTACAGGGGCAGAGGGTGGGG + Intronic
953923648 3:46969146-46969168 TGCTGGAGGAACAGAGGCAGTGG - Intronic
954013241 3:47662334-47662356 TGCTGCAGCAAAAGCGGCTTTGG - Exonic
954161883 3:48728715-48728737 GGGTGGAGGAGCAGAGGCTGAGG + Intronic
954313408 3:49787124-49787146 TGCTGTGGCAGCACAGACTGCGG - Intergenic
954317457 3:49808895-49808917 TCCTTCTGCAGCACAGGCTGAGG + Intronic
954394615 3:50286953-50286975 TGCTGCAGCAGTGAAGGATGGGG + Intronic
954608372 3:51930975-51930997 TACTGCACCATCAGAGTCTGAGG + Intergenic
954628001 3:52033214-52033236 TGAGGCTGCAGCAGAGGCTGTGG + Intergenic
954628019 3:52033289-52033311 TGCTGCCGCAGCAGGTGCTGGGG - Intergenic
954830528 3:53417684-53417706 AGCCGCAGCAACAAAGGCTGTGG - Intergenic
954876127 3:53804263-53804285 GGCTGCGGGAGCAGAGGGTGAGG - Intronic
954969342 3:54638477-54638499 GGGTGGAGGAGCAGAGGCTGAGG + Intronic
955056249 3:55458452-55458474 GGCTGGAGAAGCAGAGGGTGGGG - Intergenic
955127010 3:56122799-56122821 TGCTAAAGCAGCAGAAGCAGTGG - Intronic
955531371 3:59876462-59876484 TCCCACAGCAGCAGGGGCTGGGG - Intronic
955876199 3:63492424-63492446 CCCTGGAGCAGCAGTGGCTGGGG - Intronic
955916497 3:63912725-63912747 TGCTGCTGCCGCTGGGGCTGCGG - Exonic
956559998 3:70564896-70564918 TGCTTCTGCAGCAGTGGATGAGG + Intergenic
956741842 3:72281487-72281509 TGCTTCCTCAGCAGGGGCTGAGG + Intergenic
956744405 3:72300198-72300220 TCCTTCAGCAGCAGGGGCTGAGG - Intergenic
956931444 3:74048022-74048044 TGTTTCAGCAGCTGGGGCTGTGG - Intergenic
957059975 3:75474053-75474075 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
957295163 3:78325595-78325617 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
957317387 3:78587141-78587163 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
958675714 3:97265740-97265762 TGCAGGAGCAGCAGTGGCAGCGG - Intronic
958676898 3:97276980-97277002 GGGTGGAGGAGCAGAGGCTGAGG + Intronic
958986087 3:100781351-100781373 TACTCAAGCAGCAGAGGATGTGG - Intronic
959094464 3:101938586-101938608 TGCTACAGCAGCAGGGTCAGAGG - Intergenic
959099702 3:101996540-101996562 TCCTACAGCAGCAGGAGCTGTGG + Intergenic
959288429 3:104443912-104443934 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
959485850 3:106926724-106926746 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
959972342 3:112421556-112421578 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
960208401 3:114930840-114930862 TGTTGCAGCAGAAAAGGGTGGGG + Intronic
960282958 3:115797498-115797520 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
960310197 3:116109313-116109335 GGGTGGAGGAGCAGAGGCTGAGG + Intronic
960333509 3:116391255-116391277 TGCGGGAGCAGCAGTGGCGGTGG + Intronic
960386065 3:117023456-117023478 TGCTGCAGCTTTAGAGGATGAGG - Intronic
960495908 3:118374731-118374753 TGGTGCAGAAGGGGAGGCTGGGG + Intergenic
961058337 3:123807858-123807880 TGATGCAGCACCTAAGGCTGGGG - Intronic
961096057 3:124157905-124157927 TGCTCCAGGTGCAGTGGCTGTGG + Intronic
961096092 3:124158160-124158182 TGCTTCAGGAGCAGAGGGTGGGG - Intronic
961352662 3:126314000-126314022 TGCTGCAACAGCAGTTGATGAGG + Intergenic
961359977 3:126360831-126360853 TCCAGAAGCAGCAGGGGCTGAGG + Intergenic
961893794 3:130151161-130151183 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
962022261 3:131513106-131513128 GGGTGGGGCAGCAGAGGCTGAGG + Intergenic
963319652 3:143798963-143798985 GGGTGGAGGAGCAGAGGCTGAGG - Intronic
963521544 3:146363743-146363765 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
963732510 3:148987106-148987128 AGCTGCAGCAGCAGATGCAGAGG - Intergenic
963786736 3:149542398-149542420 AGCAGCAGCAGCAGAAACTGCGG - Exonic
964132665 3:153308076-153308098 TGCTTGAGCACCAGAGGCAGAGG - Intergenic
964300331 3:155279204-155279226 GGGTGTAGGAGCAGAGGCTGAGG + Intergenic
964430870 3:156604764-156604786 TTCTGTAGCAACACAGGCTGGGG - Intergenic
964473992 3:157082479-157082501 TGCTGCAGGAGCAAAGGCCGTGG + Intergenic
964771189 3:160225684-160225706 AGCAGCGGCAGCAGAGGCGGCGG - Exonic
964983563 3:162714095-162714117 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
964984951 3:162726542-162726564 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
965070247 3:163909257-163909279 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
965145944 3:164904061-164904083 TGCTGCTGCTGCAGAGGATTTGG + Intergenic
965286815 3:166828098-166828120 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
965624961 3:170676538-170676560 GGGTGGAGGAGCAGAGGCTGAGG + Intronic
965713325 3:171578131-171578153 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
965783507 3:172312893-172312915 TCCTGTTTCAGCAGAGGCTGTGG - Intronic
965846814 3:172972234-172972256 CAGTGAAGCAGCAGAGGCTGAGG - Intronic
966232928 3:177669841-177669863 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
966517126 3:180830183-180830205 TGCTGCAGCAGCAGAGGCTGAGG - Intronic
967152012 3:186659339-186659361 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
967740408 3:192997368-192997390 GGATGGAGGAGCAGAGGCTGAGG - Intergenic
967882309 3:194310414-194310436 CGCTCCAGGAGCAAAGGCTGCGG - Intergenic
968053243 3:195670918-195670940 GACAGCTGCAGCAGAGGCTGGGG - Intergenic
968102569 3:195977443-195977465 GACAGCTGCAGCAGAGGCTGGGG + Intergenic
968236319 3:197031903-197031925 TTCTGGAGGAGCAGAAGCTGAGG + Intergenic
968481787 4:836376-836398 GACTGCAGCTGCTGAGGCTGGGG + Intergenic
968577983 4:1376802-1376824 TGCGGCAGGAGCTGAGGCGGCGG - Intronic
968605761 4:1534567-1534589 TTCTGCAGGAGGGGAGGCTGTGG + Intergenic
968698100 4:2042394-2042416 AGCAGCAGCAGCAGCGGCGGCGG - Exonic
968776673 4:2545763-2545785 TGCTTGAGCAGGACAGGCTGAGG - Intronic
968814857 4:2817047-2817069 TGTGGCAACAGCAGGGGCTGAGG + Intronic
968871654 4:3245705-3245727 TGCTGGGGCTGCAGAGCCTGGGG - Intronic
968899178 4:3422899-3422921 TGGTGCAGCACCAGAGGCTGAGG - Exonic
968925335 4:3544198-3544220 TGGTGCAGTGGCAGAGGCTTAGG + Intergenic
968967867 4:3778420-3778442 TGTTGAAGCCGCACAGGCTGGGG - Intergenic
969195738 4:5562545-5562567 AGCTTCTGCAGCAGAGGATGGGG + Exonic
969364659 4:6687195-6687217 TGCAGCAGGGGCAGAAGCTGTGG - Intergenic
969481913 4:7451280-7451302 AGCAGCAGCAGCAGCGGCAGTGG + Intronic
969497669 4:7535269-7535291 TCCTGCAGCATCAGGGGCTTTGG - Intronic
969748975 4:9095947-9095969 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
969791723 4:9497807-9497829 TGCGGATGCAGCAGAAGCTGCGG + Intergenic
969972147 4:11058857-11058879 CACGGCAGCAGCAGAGGCTGAGG + Intergenic
970036150 4:11738227-11738249 GGCTGCAGCTGGAGTGGCTGGGG - Intergenic
970087465 4:12365455-12365477 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
970200752 4:13602120-13602142 TGCTGCAGCTGAAGAAGGTGGGG - Exonic
970928810 4:21484617-21484639 TTCTGTAGCATCAAAGGCTGCGG - Intronic
971200056 4:24502723-24502745 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
972721457 4:41703212-41703234 GGTTGCTGCAGTAGAGGCTGAGG + Intergenic
972828255 4:42786408-42786430 TACTGCAGTAGCAGTGGCAGAGG + Intergenic
973071063 4:45858861-45858883 TGCTTGAGCTCCAGAGGCTGAGG + Intergenic
973759122 4:54100794-54100816 GGCAGCAGCAGCAGCGGCGGCGG + Exonic
973804555 4:54513364-54513386 GCCTGCACCAGCAAAGGCTGTGG - Intergenic
974335430 4:60538102-60538124 TGCTTAAGCAGCAGAGTCTGTGG - Intergenic
974635997 4:64564636-64564658 TACTGCAGCACCACTGGCTGTGG - Intergenic
974683640 4:65195722-65195744 CCCTGCAGCAGCAGTGGGTGAGG + Intergenic
975278119 4:72526278-72526300 TGCTTTAGCAGCAGAGGATAAGG + Intronic
975525900 4:75350523-75350545 AACTGCAGCAGCAAAGGCTGTGG - Intergenic
975865165 4:78717856-78717878 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
975933969 4:79557976-79557998 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
975983499 4:80183921-80183943 AGCTGCTGCAGCAGAGACCGGGG + Intronic
975986252 4:80203223-80203245 TGCCGCTGCAGCCGCGGCTGCGG + Exonic
977176364 4:93825618-93825640 GGCAGCAGCAGCACAGCCTGAGG - Intergenic
977225422 4:94387467-94387489 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
977446516 4:97138624-97138646 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
977704472 4:100055915-100055937 TGCTGCAGGGGCAGAAGCTGAGG - Intergenic
977879597 4:102188629-102188651 TGGAGCATCAGCAGAGCCTGTGG - Intergenic
977937883 4:102827262-102827284 TCCTCCAGCAGGAGAGGCCGCGG + Intronic
979146537 4:117253802-117253824 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
979850386 4:125565634-125565656 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
980903857 4:138929585-138929607 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
981205272 4:142033359-142033381 ATTTCCAGCAGCAGAGGCTGAGG + Intronic
981225081 4:142284801-142284823 TGCTGTAGCTGAACAGGCTGGGG - Intronic
981470776 4:145132106-145132128 AGCTGAGGCAGGAGAGGCTGAGG - Intronic
981539645 4:145834455-145834477 GGGTGGAGGAGCAGAGGCTGAGG - Intronic
981576661 4:146213008-146213030 TGCCGGCTCAGCAGAGGCTGTGG + Intergenic
981802162 4:148670472-148670494 TTCTGCAATAGCAGAGGCTTTGG + Intergenic
981914917 4:150023211-150023233 TGCGTCAGTAGGAGAGGCTGGGG - Intergenic
982018011 4:151174924-151174946 TTCTTCAGCAGCAAAGGCCGCGG + Exonic
982134309 4:152258900-152258922 AGCTGCAGCAGGAGAGGGTGGGG - Intergenic
982257624 4:153466232-153466254 AGCTGCAGCAGCTGCGGCAGCGG + Intergenic
982265319 4:153533367-153533389 ATCTGCAGCAGCAGTGGCGGAGG + Intronic
982414277 4:155112461-155112483 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
982497187 4:156107465-156107487 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
982548711 4:156768731-156768753 TGCTAAAGGAGTAGAGGCTGGGG - Intronic
982717515 4:158824533-158824555 AGCTCCAGCAGCAGAGGTGGGGG - Intronic
983414790 4:167439803-167439825 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
983452255 4:167924606-167924628 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
983498546 4:168473161-168473183 TGCGGCTGCAGCAGAGGGTAAGG + Intronic
983563198 4:169122174-169122196 AGCAGCAGCAGCAGCGGCGGTGG + Exonic
984393693 4:179168888-179168910 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
984405749 4:179327660-179327682 TCCTGTAGCAACAGAGCCTGAGG + Intergenic
984437182 4:179722129-179722151 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
985041458 4:185895488-185895510 TTCTGCTGCAGCAGATGCAGCGG + Intronic
985057479 4:186048231-186048253 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
985079088 4:186246166-186246188 GGGTGGAGGAGCAGAGGCTGAGG + Intronic
985275125 4:188230953-188230975 TGCTGCACCAGCTGAAGCTCCGG - Intergenic
985389951 4:189483461-189483483 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
985435644 4:189927533-189927555 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
985499491 5:233265-233287 GACAGCTGCAGCAGAGGCTGGGG - Intronic
985655932 5:1131349-1131371 TTCAGCAGCTGCTGAGGCTGAGG - Intergenic
985746724 5:1652272-1652294 GGGTGCACAAGCAGAGGCTGTGG + Intergenic
985869083 5:2539516-2539538 TCCTTCAGCAGCAGAAGCTTGGG + Intergenic
985872757 5:2570318-2570340 TGCTGCAGAGGCAGATGCTGTGG + Intergenic
986707613 5:10464366-10464388 CGGTGCAGAAGCAGAGGCTGTGG - Intronic
986748173 5:10761662-10761684 CGCTGCCGCGGCAGGGGCTGAGG - Intergenic
986784826 5:11104710-11104732 TTCGGCTGCAGCTGAGGCTGAGG + Intronic
986905698 5:12491549-12491571 GGGTGCAGGAGCAGAGGCTGAGG - Intergenic
986919665 5:12666538-12666560 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
987258151 5:16179112-16179134 CGCAGCAGCAGCAGTGGCGGCGG - Exonic
987401878 5:17486414-17486436 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987403124 5:17498412-17498434 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987405305 5:17518548-17518570 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987405750 5:17521982-17522004 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987406197 5:17525416-17525438 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987407502 5:17585555-17585577 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987408200 5:17590757-17590779 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987408648 5:17594191-17594213 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987409104 5:17597625-17597647 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987412893 5:17632269-17632291 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987413167 5:17634641-17634663 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987661810 5:20887999-20888021 GGCTGGAGCAGCAAGGGCTGGGG + Intergenic
987708307 5:21482200-21482222 TGCTGCAGCTGCAGGAGCGGAGG + Intergenic
988408962 5:30861230-30861252 GGCTGCAGCAGGAGAGTCTCAGG + Intergenic
988761773 5:34317320-34317342 GGCTGGAGCAGCAAGGGCTGGGG - Intergenic
988922787 5:35960475-35960497 TTGAGCAGCAGCGGAGGCTGCGG - Intronic
990039100 5:51357697-51357719 AGCTGCAGCAGCAAATGCTGTGG + Intergenic
991349240 5:65703606-65703628 TGATGTCCCAGCAGAGGCTGAGG + Intronic
991565048 5:67996676-67996698 GCCTGAAGCAGCACAGGCTGAGG - Intergenic
991736789 5:69635498-69635520 TGCTGCAGCTGCAGGAGCCGAGG - Intergenic
991813114 5:70490327-70490349 TGCTGCAGCTGCAGGAGCCGAGG - Intergenic
991816245 5:70511608-70511630 TGCTGCAGCTGCAGGAGCCGAGG - Intergenic
991936902 5:71810976-71810998 CGCTGCAGCTGCAGAGCCTGAGG - Intergenic
992414785 5:76542065-76542087 TGCTGCAGCCCAAGAGGGTGAGG - Intronic
992452137 5:76884756-76884778 GGGTGCGGAAGCAGAGGCTGAGG + Intronic
992598419 5:78369818-78369840 TGCTCCCTCAGCAGAAGCTGAGG - Intronic
992690424 5:79236212-79236234 TGCAGCAGCACCAGGGGCGGGGG + Exonic
992783357 5:80147738-80147760 TTCTCCAGAAGCAGAGGCTGAGG - Intronic
993045619 5:82862863-82862885 TGCTGCTGCTGCTGATGCTGAGG - Intergenic
993152712 5:84181317-84181339 TGCTGCCACAGCAGATCCTGTGG - Intronic
993342196 5:86738550-86738572 AGCAGTAGCAGCAGAGGTTGTGG + Intergenic
993647022 5:90474560-90474582 TGGTGCGGCTGCCGAGGCTGCGG - Exonic
994061738 5:95486256-95486278 AGCTCCAGCAGCAGTGGCTGTGG - Intronic
994126191 5:96170908-96170930 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
994989469 5:106980091-106980113 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
995253412 5:110019150-110019172 TGCTGCAGTGGCAGTGGCAGAGG - Intergenic
996203338 5:120701589-120701611 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
996344901 5:122477603-122477625 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
997254882 5:132420791-132420813 TGCGGCAGAAGGAGAAGCTGGGG + Intronic
997350010 5:133224215-133224237 AACTGCAGCAGCAGAGAATGAGG + Exonic
997599052 5:135127109-135127131 TGCCGCGGCTGCAGGGGCTGGGG + Intronic
997608146 5:135191462-135191484 GGCTGCAGCGGCAGAGGCCGAGG - Intronic
997631755 5:135374036-135374058 TGCTGCAGCAGCAGAGGGCCGGG + Intronic
997714480 5:136031872-136031894 TGTGGCAGCAGCAGAGGCTGGGG - Intronic
997769755 5:136543612-136543634 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
997770756 5:136550696-136550718 AGGTGAAGGAGCAGAGGCTGAGG + Intergenic
997772719 5:136569332-136569354 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
998331675 5:141332813-141332835 TGCTGCTGGCGCACAGGCTGCGG + Exonic
998340754 5:141415316-141415338 TGCTGCTGGCGCACAGGCTGCGG + Exonic
998693788 5:144615378-144615400 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
999150622 5:149423895-149423917 TTCTGCAGCAGCAGAGTCCTGGG + Intergenic
999177190 5:149639846-149639868 TGCTCCAGTATCAGTGGCTGTGG + Intergenic
999229419 5:150052851-150052873 GGCTGCAGCAGCAGTGGCCAGGG - Intronic
999330923 5:150672767-150672789 TTCTGCAGATGAAGAGGCTGCGG + Intronic
999432514 5:151536501-151536523 TGCTGCTGCAGGGGAGGGTGTGG - Intronic
999542068 5:152584786-152584808 TTCTGCAGCTGCAGTGGCAGAGG + Intergenic
1000907341 5:166978801-166978823 GGCTGCAGCTGCTGTGGCTGCGG - Intergenic
1001051943 5:168420747-168420769 TGCAGGAGCAGCTGAGGCTGAGG - Intronic
1001143479 5:169164373-169164395 TGAAGAAGCAGCAGAGTCTGTGG + Intronic
1001748207 5:174108220-174108242 TTCTGCATCAGCAAACGCTGAGG + Exonic
1002286409 5:178165487-178165509 AGATGCAACAGCTGAGGCTGGGG + Intergenic
1002611044 5:180418724-180418746 GGGTGCAGGAGCGGAGGCTGAGG + Intergenic
1003097782 6:3156303-3156325 TCCTGCAGCAGCCGCTGCTGAGG + Intronic
1003105440 6:3211505-3211527 AGCTGTAGCAGCAGGGACTGAGG + Intergenic
1003188112 6:3850104-3850126 GGCTGCAGCAGGAGCGGCAGCGG + Exonic
1003211380 6:4070910-4070932 TGCTTCAGCCTCAGAGGTTGAGG + Intronic
1003242006 6:4353204-4353226 GGCAGCAGCAGGAGAGGCGGTGG + Intergenic
1003400505 6:5786755-5786777 TGCTGCTGCTGCAGCCGCTGAGG + Intergenic
1004283602 6:14300949-14300971 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1005491196 6:26349004-26349026 TGCTTGAGCCGGAGAGGCTGAGG - Intergenic
1005661186 6:28001110-28001132 TGTGGCTGCAGCAGGGGCTGTGG + Intergenic
1005740468 6:28786146-28786168 GGCTGCGGCAGCAAAGGCGGAGG + Intergenic
1006106913 6:31722272-31722294 TGCCACAGCAGCAGAGGCAGGGG + Intronic
1006144783 6:31952197-31952219 TGCTGAAAAACCAGAGGCTGAGG + Exonic
1006421285 6:33935685-33935707 TGCTGCAGCAGAGGCAGCTGCGG + Intergenic
1007304084 6:40890923-40890945 TCACGCAACAGCAGAGGCTGAGG - Intergenic
1007497249 6:42268644-42268666 TGCTGCAGCTGTAGCTGCTGCGG + Exonic
1007665292 6:43509935-43509957 TGCGGCTGCGGCGGAGGCTGCGG + Exonic
1007680290 6:43629053-43629075 GCCGGCAGCAGCAGCGGCTGCGG - Exonic
1008813515 6:55534632-55534654 AGCTGCAACAGCAGGGGCAGGGG - Intronic
1008886202 6:56433284-56433306 TGCAGCAGCAGCCGCGGCTGCGG - Intergenic
1009343528 6:62587655-62587677 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1009888873 6:69656444-69656466 TGCTGCAGAGGCAGTGGCAGAGG - Intergenic
1010269052 6:73900834-73900856 GGCTACTGCAGCAGGGGCTGAGG + Intergenic
1010366299 6:75055606-75055628 GGCTGCAGCAGGCCAGGCTGAGG + Intergenic
1010841396 6:80651835-80651857 GGGTGGAGGAGCAGAGGCTGTGG + Intergenic
1011009544 6:82688104-82688126 TGAAGCAGCACCAGATGCTGTGG - Intergenic
1011175163 6:84552010-84552032 TGATGCAACAGCACATGCTGAGG - Intergenic
1011367982 6:86602369-86602391 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1011734388 6:90296805-90296827 TGCTGCTGCTGCTGAGGCGGCGG + Intronic
1011771024 6:90674210-90674232 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1012014470 6:93834076-93834098 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1012066624 6:94557944-94557966 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1012215031 6:96572366-96572388 TGCTGCTTCAGCAGGGGCAGGGG + Intronic
1012315742 6:97781308-97781330 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1013575798 6:111482932-111482954 AGCGGCAGCAGCAGCGGCGGCGG + Exonic
1013793034 6:113857645-113857667 AGCAGCAGCAGCAGCGGCGGCGG - Exonic
1014718813 6:124893748-124893770 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1014747115 6:125213573-125213595 TGCTCCTGCATCAGGGGCTGGGG - Intronic
1014794071 6:125705860-125705882 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1014799306 6:125759664-125759686 CGCAGCAGCAGCAGTGGCCGCGG + Exonic
1015278072 6:131404524-131404546 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1015288113 6:131508278-131508300 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1015712312 6:136155671-136155693 GGCTGCAGCAGCACACGATGTGG + Exonic
1015954990 6:138589822-138589844 TGCTGGGGATGCAGAGGCTGGGG - Intronic
1016248784 6:142017526-142017548 GGATGGAGGAGCAGAGGCTGAGG - Intergenic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1016714130 6:147204206-147204228 AGCAGCAGCAGCAGTGGCGGCGG - Intergenic
1017779413 6:157704682-157704704 GGGTGGAGGAGCAGAGGCTGAGG + Intronic
1018146886 6:160900075-160900097 TGCTGCAGCTGCAATGGCAGAGG - Intergenic
1018254143 6:161901855-161901877 AGCTGCAGCAGCAGGGTCAGAGG - Intronic
1018259876 6:161959428-161959450 TGTGGCTGCTGCAGAGGCTGTGG - Intronic
1018287543 6:162257059-162257081 TGCCGGGGCAGCACAGGCTGAGG - Intronic
1018394701 6:163369326-163369348 AGAAGCAGCAGCAGATGCTGCGG + Intergenic
1019793585 7:3033425-3033447 TGCTGCAGCTGCCCAGTCTGTGG + Intronic
1019973569 7:4561913-4561935 TGCTGCAGCAGGATTGGCTCTGG + Intergenic
1020324023 7:6960693-6960715 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1020418568 7:7972206-7972228 GTCTGCAGCAGCAGTGGCAGCGG - Intronic
1020541212 7:9462529-9462551 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1021313142 7:19117029-19117051 GGCGGCAGCAGCAGCGGCGGCGG - Exonic
1021637234 7:22704956-22704978 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1021800377 7:24299464-24299486 CGATGAAGCAGCAGTGGCTGAGG + Intergenic
1022286007 7:28956671-28956693 TGCTGCTGGAGCTGCGGCTGCGG + Exonic
1022322701 7:29302215-29302237 AGCTGCAGCAGCAGCGGTGGCGG - Intronic
1022396203 7:29989747-29989769 GGCTGCAGCTGCAGTGGCGGAGG + Intronic
1022857140 7:34326238-34326260 TCAGGCAGCAGCTGAGGCTGTGG + Intergenic
1023287566 7:38634753-38634775 TGCTGCTGAAACAGAGGTTGTGG + Intergenic
1023545351 7:41312529-41312551 AGAAGCAGCAGCGGAGGCTGAGG - Intergenic
1023554443 7:41406244-41406266 TGCCGCAGAAGCAGTGGCTGAGG + Intergenic
1023664778 7:42511825-42511847 TGCTGGAGCAGCAGGGGCCTGGG - Intergenic
1023830589 7:44036876-44036898 TGCTGCAGAAGGGGAGACTGAGG - Intergenic
1024346400 7:48319035-48319057 TGCAGCAGAGGCACAGGCTGTGG + Intronic
1024697543 7:51871729-51871751 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1024901495 7:54323410-54323432 GGTATCAGCAGCAGAGGCTGCGG + Intergenic
1025176042 7:56802984-56803006 TGCTGCACCTGGAGAGGCCGTGG + Intergenic
1025625437 7:63217083-63217105 TGCTGCAGCAGGAAAGGTTAGGG - Intergenic
1025809280 7:64864041-64864063 TGCTGCGGGAGGAGCGGCTGCGG + Intergenic
1026468481 7:70674617-70674639 TGGTGCAGCGGCAGAGGAGGTGG - Intronic
1026607221 7:71826517-71826539 TGCTTCAGGAGCAGAGACTGGGG - Intronic
1026883480 7:73921984-73922006 TACAGCAGCAGCAGCAGCTGGGG - Intergenic
1026903929 7:74051949-74051971 AGCTGCAGCAGCAGCCGCTAAGG + Exonic
1026959687 7:74400430-74400452 TGCTGCAGCCGCAGAAGCTCGGG - Exonic
1027144340 7:75683604-75683626 TGCTGCACCTCCAGAGGCTCCGG - Intronic
1027851866 7:83461380-83461402 GGGTGGAGGAGCAGAGGCTGAGG - Intronic
1028688211 7:93617793-93617815 AGTTGTAGCAGTAGAGGCTGAGG - Intronic
1029031388 7:97471026-97471048 TTCTGCAGAAAGAGAGGCTGGGG + Intergenic
1029422720 7:100479355-100479377 AACTGCAACAGCAGCGGCTGTGG - Intergenic
1029487510 7:100852603-100852625 AGCTGGAGCAGCGCAGGCTGGGG + Intronic
1029740919 7:102491190-102491212 TGCTGCAGAAGGGGAGACTGAGG - Intronic
1029758913 7:102590363-102590385 TGCTGCAGAAGGGGAGACTGAGG - Intronic
1029926918 7:104328478-104328500 TGCAGCAGCTGCAGCGGCGGCGG + Intergenic
1030111618 7:106031566-106031588 AGCAGCAGCAGCAGCGGCGGCGG - Intronic
1030441773 7:109596054-109596076 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1031004589 7:116457195-116457217 GGGTGGAGGAGCAGAGGCTGAGG - Intronic
1031377586 7:121047181-121047203 ATCTGCAGCAGCTGAAGCTGAGG - Intronic
1031499417 7:122494168-122494190 TGCTGCCTCAGCAGAAGCTGAGG - Intronic
1031685766 7:124730741-124730763 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1031732695 7:125317923-125317945 TACTCCAGCAGCTGAGGCAGGGG + Intergenic
1031776248 7:125911700-125911722 GGATGGAGGAGCAGAGGCTGAGG - Intergenic
1032372186 7:131367857-131367879 TGCTCCTTCAGTAGAGGCTGTGG + Intronic
1032794571 7:135267478-135267500 AGCTGCAGCAGGAGAGGATGAGG + Intergenic
1033300010 7:140177015-140177037 TCCTGCAGCAGCCGCGGCGGCGG + Exonic
1033676033 7:143541220-143541242 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1033695802 7:143788219-143788241 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1034187735 7:149191957-149191979 TGCTGTAGCTGCACAGGCTGTGG - Intergenic
1034292623 7:149945082-149945104 TTCCCCAGAAGCAGAGGCTGAGG + Intergenic
1034462293 7:151204635-151204657 TGGTGCAGCCGCAGAAGCGGCGG - Exonic
1034485162 7:151356120-151356142 TGTTACAGCAGCAGAGACAGTGG + Exonic
1034680167 7:152922546-152922568 AGCAGCAGCCGCAGAGGCCGTGG + Intergenic
1034813448 7:154151810-154151832 TTCCCCAGAAGCAGAGGCTGAGG - Intronic
1035133336 7:156675900-156675922 AGCTGCAGCTGCAGAGGCTGTGG + Intronic
1035453104 7:158991858-158991880 TGCAGCAGCTGCCGGGGCTGAGG + Intergenic
1035591877 8:822388-822410 GGCAGAAGCAGGAGAGGCTGCGG + Intergenic
1036457178 8:8920073-8920095 TGATGCAGCAGCAAAGGAAGTGG - Intergenic
1037150024 8:15626064-15626086 TGCAGGAGCAGCAGTGGCAGTGG + Intronic
1037591140 8:20313143-20313165 TGCATCAACAGCAGAGGCAGTGG - Intergenic
1037887907 8:22604772-22604794 GGCGGCGGCAGCAGCGGCTGTGG + Exonic
1038055599 8:23854743-23854765 AGCAGCAGCAGCAGCGGCGGTGG - Exonic
1038055601 8:23854749-23854771 TGCAGCAGCAGCAGCAGCAGCGG - Exonic
1038180187 8:25220503-25220525 GTCTGCAGCAGGAGGGGCTGGGG + Intronic
1038773836 8:30510117-30510139 AGCAACAGCAGCAGAGACTGAGG - Intronic
1039821153 8:41136802-41136824 AGCTGGAGAAGCAGAGGCAGGGG - Intergenic
1040334802 8:46410619-46410641 TGGTCCAGCAGCAGAGACTCAGG + Intergenic
1041143524 8:54847081-54847103 AGATGCACCAGCAGATGCTGAGG - Intergenic
1041910731 8:63086024-63086046 TGCGGCCGCAGCAGCGGCGGCGG - Exonic
1042130083 8:65579483-65579505 GGCTGCTGCACCAGGGGCTGAGG - Intergenic
1042187755 8:66154100-66154122 CCCTGCAGCAGCAGAAACTGCGG + Exonic
1042247313 8:66720860-66720882 TGCTTGAGCTGCAGAGGCGGAGG + Intronic
1042316798 8:67434695-67434717 TGCTGCAGCTGCAGCTGCTGCGG - Intronic
1042453473 8:68974884-68974906 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1042707286 8:71676624-71676646 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1043001607 8:74767043-74767065 TGCTTGAGCAGGGGAGGCTGAGG - Intronic
1043353752 8:79390104-79390126 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1043411739 8:80004342-80004364 GGTATCAGCAGCAGAGGCTGCGG - Intronic
1043568274 8:81571468-81571490 GGCGGCAGCAGAGGAGGCTGAGG - Intergenic
1043769684 8:84183130-84183152 GGCAGCAGCGGCAGAGGCGGCGG + Intronic
1043932673 8:86108538-86108560 TTCAGCAGCAGCAGAGTGTGGGG + Intronic
1044148592 8:88746214-88746236 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1044417007 8:91949715-91949737 GGGTGCAGGAGCAGAGGCTGAGG - Intergenic
1044927902 8:97224693-97224715 TCCTGCAGAAGCAGCGGCAGAGG - Intergenic
1045202819 8:100002942-100002964 TCCAGCTGCTGCAGAGGCTGAGG + Intronic
1046386422 8:113513512-113513534 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1046443172 8:114283704-114283726 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1047829620 8:128615907-128615929 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1047856289 8:128916103-128916125 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1047995281 8:130329163-130329185 TGAGGCAGCAGCAGTGGTTGAGG - Intronic
1048143690 8:131820867-131820889 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1048278089 8:133082528-133082550 TGCTGCAGCAGAGCAGGCTGTGG + Intronic
1048442874 8:134472756-134472778 TGCAGGAGCCCCAGAGGCTGGGG - Intergenic
1048585499 8:135771145-135771167 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1049168711 8:141144038-141144060 AGCTGCTGCTGCAGACGCTGGGG + Intronic
1049289660 8:141795108-141795130 TGATGAAGCCTCAGAGGCTGGGG - Intergenic
1049689792 8:143953461-143953483 TGCTGCAGCGGCGGCGGCGGCGG - Intronic
1049795749 8:144496601-144496623 AGGTGCAGCCGCTGAGGCTGGGG - Exonic
1049809092 8:144555286-144555308 TGCTGCTCCACCAGGGGCTGAGG + Intronic
1050676590 9:8062745-8062767 GCCAGCAGCAGCAGTGGCTGTGG + Intergenic
1051234290 9:14982307-14982329 TGATGCAGCACCAGATGCTAGGG - Intergenic
1052191747 9:25670612-25670634 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1052855738 9:33405055-33405077 CACTGAAGAAGCAGAGGCTGAGG + Intergenic
1053030977 9:34777602-34777624 TGCTACTGCAGCAAGGGCTGAGG - Intergenic
1053146360 9:35714767-35714789 CTCTGCACCAGCAGGGGCTGGGG + Exonic
1053146424 9:35715140-35715162 AGGAGCAGCAGCAGCGGCTGCGG - Exonic
1053272691 9:36761187-36761209 CCCTGCAGATGCAGAGGCTGTGG - Intergenic
1053656407 9:40222081-40222103 TTCTGCAGCAGCCGAGGCGCTGG - Intergenic
1053800227 9:41759380-41759402 TGGTGCAGTGGCAGAGGCTTGGG + Intergenic
1053906756 9:42851299-42851321 TTCTGCAGCAGCTGAGGCGCTGG - Intergenic
1054076934 9:60545920-60545942 GGCTGCAGCTGCAGTGTCTGTGG - Intergenic
1054144967 9:61555455-61555477 TGGTGCAGTGGCAGAGGCTTGGG - Intergenic
1054188655 9:61971532-61971554 TGGTGCAGTGGCAGAGGCTTGGG + Intergenic
1054368512 9:64368303-64368325 TTCTGCAGCAGCTGAGGCGCTGG - Intergenic
1054464662 9:65486412-65486434 TGGTGCAGTGGCAGAGGCTTGGG - Intergenic
1054528210 9:66154204-66154226 TTCTGCAGCAGCTGAGGCGCTGG + Intergenic
1054649866 9:67617085-67617107 TGGTGCAGTGGCAGAGGCTTGGG - Intergenic
1054676137 9:67858055-67858077 TTCTGCAGCAGCCGAGGCGCTGG - Intergenic
1054807569 9:69408778-69408800 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1055232981 9:74087376-74087398 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1055442901 9:76354146-76354168 TGTTGCAGCAGTGGAGGCAGTGG - Exonic
1055673643 9:78632617-78632639 GGCTGCACCAGCTGAGGCAGAGG + Intergenic
1055770201 9:79708746-79708768 GGCAGCAGCAGCAGCGGCGGCGG - Exonic
1055809968 9:80139121-80139143 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1056044819 9:82704709-82704731 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1056323804 9:85460358-85460380 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1056329841 9:85512100-85512122 GGCTGGAGAAGCAGAGGCTGGGG - Intergenic
1056437320 9:86587309-86587331 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1056522363 9:87412638-87412660 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1056710748 9:88990792-88990814 TGGTGCACCAGCAGAGGCTGGGG + Intergenic
1056935295 9:90911532-90911554 TCCTGCAACAGTGGAGGCTGGGG + Intergenic
1057020966 9:91697450-91697472 TGCCGCAGCAGGAAGGGCTGGGG + Intronic
1057190150 9:93082851-93082873 TGCGGCAGCGGCAGCAGCTGTGG - Intronic
1057196740 9:93119768-93119790 GGGGGCAGCAGCACAGGCTGAGG + Intergenic
1057295177 9:93830477-93830499 TGCTATAGTAGCAGAGCCTGTGG + Intergenic
1057683888 9:97216340-97216362 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1057904650 9:98974548-98974570 TGCTGCAGGCGCAGAGGAGGGGG + Intronic
1057932949 9:99211980-99212002 TGCAGCAGCAGCAATGGTTGGGG + Intergenic
1057982001 9:99671877-99671899 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1058021549 9:100094886-100094908 TGCTTCAGCCTCAGAGGTTGAGG + Intronic
1058651888 9:107182314-107182336 TGCCTCAGCAGCCTAGGCTGTGG - Intergenic
1058958939 9:109974701-109974723 TGCTGCAGCACCAGAGTATGGGG + Intronic
1058994721 9:110288355-110288377 TGCTTCAGCACCAGAGGCAAAGG + Intergenic
1059409374 9:114122541-114122563 TTCTTCAGCAGCAGAGCCTTAGG - Intergenic
1059453797 9:114387302-114387324 CGCTCCAGCAGCAGAGGCCGAGG + Intronic
1059914244 9:119080896-119080918 AGCTCCAGCAGCAGATACTGTGG + Intergenic
1059932256 9:119272683-119272705 TGCTGCAGCAGGAAATGGTGTGG - Intronic
1060065934 9:120501161-120501183 TGCTGGAGCAGAACTGGCTGCGG - Intronic
1060195563 9:121621184-121621206 AGCTGCACCAGAAGGGGCTGTGG - Intronic
1060226068 9:121791660-121791682 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1060381004 9:123172143-123172165 TGCTGCAACATCTGAGGATGAGG + Intronic
1060735260 9:126062696-126062718 TGAGTCAGCAGCAGAGGCTTCGG - Intergenic
1060737965 9:126078653-126078675 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1060931460 9:127491910-127491932 GTCTGCAGCTGGAGAGGCTGAGG - Intronic
1061367054 9:130177560-130177582 AGCAGCAGCAGGAGAGACTGAGG + Intronic
1061377177 9:130233436-130233458 TTCGGCAGCCGGAGAGGCTGTGG + Exonic
1061411782 9:130425819-130425841 TGCTGCACCAGCTGGGGCTGGGG - Exonic
1061809856 9:133155904-133155926 TGCTCCAGCAGCTTGGGCTGAGG + Exonic
1061991748 9:134163193-134163215 TGCTGAAACAGCCAAGGCTGCGG - Intergenic
1062036835 9:134386223-134386245 CGCTGCATCACCCGAGGCTGTGG + Intronic
1062137836 9:134939026-134939048 GGCTGCAGCAGCAGAGGGGTGGG - Intergenic
1062394134 9:136345921-136345943 AGCTGCACCACCCGAGGCTGGGG + Intronic
1203748363 Un_GL000218v1:57257-57279 TTCTGCAGCAGCTGAGGCGCTGG - Intergenic
1203561365 Un_KI270744v1:60764-60786 TTCTGCAGCAGCTGAGGCGCTGG + Intergenic
1186612904 X:11155837-11155859 TGCTGCAGAGGCAGAGGGTGTGG - Intronic
1187205132 X:17174797-17174819 AGCAGCAGCAGCAGCGGCGGCGG - Intergenic
1187490602 X:19747914-19747936 TGCTAGAGCAGCAGTTGCTGGGG + Intronic
1187547323 X:20266768-20266790 AGCAGCAGCAGCAGCGGCGGCGG + Exonic
1187932956 X:24311040-24311062 TGCAGCAGCAGCAGCGGCTGTGG + Intergenic
1188444504 X:30242335-30242357 AGCTGCAGCAGCAGAGGTGGTGG - Exonic
1188445668 X:30250690-30250712 AGCTGCAGCAGCAGTGGTGGTGG - Exonic
1188552568 X:31379200-31379222 GGGTGGAGGAGCAGAGGCTGAGG - Intronic
1189081294 X:37975375-37975397 TACTGGAGCAGCAGGGACTGAGG + Intronic
1189498273 X:41529394-41529416 GGCAGCAGCAGCAGTGGCGGTGG + Intronic
1189659324 X:43279716-43279738 AGCAGCAGCAGCAGTGGCGGCGG - Intergenic
1189870927 X:45381931-45381953 TGCTGCTGCAGCTGGTGCTGGGG - Intergenic
1190114104 X:47614477-47614499 AACTGCAGCAGCAGAGACTATGG + Intronic
1191830020 X:65406740-65406762 AGCAGCAGCAGCAGAAGCAGCGG + Intronic
1191956708 X:66650111-66650133 GGAATCAGCAGCAGAGGCTGCGG + Intergenic
1192104055 X:68296108-68296130 TACTCCAACAGCTGAGGCTGAGG - Intronic
1192180548 X:68913134-68913156 TGCTGCTGCGGCTGCGGCTGCGG - Intergenic
1192180549 X:68913140-68913162 TGCTGCTGCTGCTGCGGCTGCGG - Intergenic
1192263428 X:69523047-69523069 AGCTGCAGCCGCAGAGCCTGTGG - Intronic
1192268389 X:69556051-69556073 TGCAGCAGCTGCAGAGGGAGAGG + Intergenic
1192435439 X:71140835-71140857 AGCAGCAGCAGCAGATCCTGCGG + Exonic
1192557486 X:72101946-72101968 GGCTGAAGCAGTAGAGGCTGGGG - Intergenic
1192631949 X:72784195-72784217 AACTGCAGCAGCAGGGGCTCAGG - Intronic
1192649760 X:72936606-72936628 AACTGCAGCAGCAGGGGCTCAGG + Intronic
1192657056 X:73003255-73003277 TGCGGCGGCGGCGGAGGCTGCGG + Intergenic
1192657113 X:73003459-73003481 CGCCGCCGCAGCGGAGGCTGCGG + Intergenic
1192665007 X:73079542-73079564 CGCCGCCGCAGCGGAGGCTGCGG - Intergenic
1192665064 X:73079746-73079768 TGCGGCGGCGGCGGAGGCTGCGG - Intergenic
1192952306 X:76029687-76029709 GGGAGCAGCAGCAGAGGCGGAGG + Intergenic
1193440539 X:81535493-81535515 TGCTGCAGCATCAGTGACAGAGG + Intergenic
1193885856 X:86983518-86983540 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1193941415 X:87683604-87683626 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1193977225 X:88136503-88136525 TGCTGCAGCTTCAGAGGAGGCGG + Intergenic
1194318504 X:92412130-92412152 AGCAGCAGCAGCAGAGGAGGAGG + Intronic
1194358785 X:92920619-92920641 TGCTGAAGCTGCAGGGGGTGGGG + Intergenic
1194690921 X:96983466-96983488 TTCTGCAGTAGCAGTGCCTGAGG + Intronic
1194965499 X:100284273-100284295 TGCTGATGCAGCAGGGCCTGGGG + Intergenic
1195220300 X:102739858-102739880 TTCTGCAGCAGCAAAGGCACAGG - Intronic
1195330702 X:103796941-103796963 AGCTGTAGCCCCAGAGGCTGCGG + Intergenic
1195349075 X:103979980-103980002 GGCTGCAGCAGCCCAGGCTGGGG - Intergenic
1195351058 X:103997339-103997361 GGCTGCAGCAGCCCAGGCTTGGG + Intergenic
1195352651 X:104009489-104009511 GGCTGCAGCAGCCCAGGCTGGGG + Intergenic
1195356443 X:104044073-104044095 GGCTGCAGCAGCCCAGGCTGGGG - Intergenic
1195358368 X:104058859-104058881 GGCTGCAGCAGCCCAGGCTGGGG + Intergenic
1195736748 X:108019566-108019588 TGCTGCAGCTGCAGACACTGTGG - Intergenic
1195799300 X:108688879-108688901 TTCTGCAGCAGCAGAGACCCCGG + Intronic
1195908758 X:109869212-109869234 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1196165465 X:112532329-112532351 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1196341796 X:114605299-114605321 GGGTGGAGGAGCAGAGGCTGAGG + Intronic
1196496782 X:116332499-116332521 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1197055485 X:122113765-122113787 TGCTGCAGCTGCAGCTGCTGTGG + Intergenic
1197064832 X:122223748-122223770 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1197352140 X:125392842-125392864 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1197470878 X:126864791-126864813 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1197720886 X:129743844-129743866 CGCTGCTTCAGGAGAGGCTGGGG + Intronic
1198005384 X:132488896-132488918 AGCGGCAGCAGCAGGGGCAGCGG + Intronic
1198406622 X:136319210-136319232 TGCTGGAGGCCCAGAGGCTGCGG + Intronic
1198598374 X:138260498-138260520 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1198599477 X:138268306-138268328 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1198797657 X:140416178-140416200 GGCTGCAGGAGCAGCAGCTGGGG - Intergenic
1199346304 X:146745419-146745441 GCCTGCTGCAGTAGAGGCTGAGG + Intergenic
1199440852 X:147866440-147866462 TGCAGCAGCAGCATGGGGTGGGG + Intergenic
1199538388 X:148929923-148929945 TGCTGCAGCATCATAGCCTTAGG + Intronic
1199576399 X:149317374-149317396 GGGTGGAGGAGCAGAGGCTGAGG - Intergenic
1199593450 X:149488712-149488734 GGCTGCAGCAGCACAGGCTGAGG - Intronic
1199598567 X:149526719-149526741 GGCTGCAGCAGCACAGGCTGAGG + Intronic
1199978812 X:152909599-152909621 TGCTGCAGCGGCAGTGGCAGTGG - Intergenic
1200056744 X:153465553-153465575 TCCTGCCGCAACAGAGTCTGTGG + Intronic
1200138499 X:153886153-153886175 TGCTGCGGCAGCAGCGGCTGTGG + Intronic
1200230714 X:154442683-154442705 GGCTGGGGCAGCAGGGGCTGGGG - Exonic
1200395425 X:155983766-155983788 TGCTGCAGGGGCAGATGTTGGGG + Intergenic
1200666951 Y:6036313-6036335 TGCTGAAGCTGCAGGGGGTGGGG + Intergenic
1201161710 Y:11172227-11172249 TTCTGCAGCAGCTGAGGCGCTGG - Intergenic
1201473572 Y:14358452-14358474 GGGTGCATGAGCAGAGGCTGAGG + Intergenic
1201724893 Y:17140704-17140726 GGGTGGAGGAGCAGAGGCTGAGG + Intergenic
1202367012 Y:24172509-24172531 TGCTGGAACAGGAGAGGCTTTGG + Intergenic
1202503769 Y:25497614-25497636 TGCTGGAACAGGAGAGGCTTTGG - Intergenic