ID: 966517246

View in Genome Browser
Species Human (GRCh38)
Location 3:180831429-180831451
Sequence GTTGTTTTTCTTGAAACGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 1, 2: 15, 3: 77, 4: 319}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966517246 Original CRISPR GTTGTTTTTCTTGAAACGAC AGG (reversed) Intronic
900712953 1:4126455-4126477 GTTGTTTTCCTTGAAGTGACAGG + Intergenic
900779769 1:4610535-4610557 ATTGTTTGGCTTGAAACAACAGG + Intergenic
901119601 1:6880245-6880267 TTTGTTTTTCTTGTATAGACAGG + Intronic
901145309 1:7060905-7060927 TTTGTTTTTTTGGAACCGACTGG + Intronic
901928274 1:12580752-12580774 GTCATTTGTCTTGAAATGACTGG + Intronic
902356298 1:15903661-15903683 GTTGTTGTTTATGAAAAGACTGG + Intronic
903994275 1:27295935-27295957 TTTGTATTTCTTGTAAAGACGGG + Intronic
904071885 1:27806232-27806254 GTTGTTTTCCTTGAAGTGACAGG + Intronic
905552329 1:38852969-38852991 TTTGTTTTTCTTCACACCACTGG + Intronic
906045079 1:42823515-42823537 GTTGCTTTTCCTGAAGTGACAGG + Intronic
906167935 1:43701375-43701397 TTTGTTTTCCTTGACATGACAGG + Intronic
906500585 1:46339495-46339517 GTTATTTTCCTTGAAGTGACAGG - Intergenic
907694080 1:56703717-56703739 GTTGTTTTCCTTAAAGCGATGGG + Intronic
907709510 1:56865694-56865716 TTTGTTTTCCTTGAAATGATAGG - Intronic
908153064 1:61324406-61324428 GTTCTTTTTGATGAAATGACTGG + Intronic
908199204 1:61777145-61777167 GTTGTTTTCCTTGAAATAACAGG - Intronic
909045997 1:70710552-70710574 TTTCTTTATCTTGAAATGACAGG - Intergenic
910304569 1:85748165-85748187 GTTGTTTTCCTTGAAATGGAAGG + Intronic
910652958 1:89589696-89589718 GCTGTGTTTCTTGAAATGATTGG + Intronic
910798964 1:91126675-91126697 GTCATTTTTCTTGAAGTGACAGG + Intergenic
910871786 1:91840775-91840797 GTTGTTTTCCTTGAACTAACAGG + Intronic
911045843 1:93626993-93627015 GTTGTTTTCCTTGAAGTAACAGG - Intronic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
912992580 1:114503767-114503789 GTTGTTTTCCTGGAAATGACAGG + Intronic
913353771 1:117894783-117894805 ATTATTTTTCTTGAAATGTCAGG - Intronic
915044113 1:152997194-152997216 GTTGTTTTCCTTGAAATGAAAGG + Intergenic
916322461 1:163520257-163520279 GTGGCTTTTATTGAAAAGACAGG + Intergenic
916478068 1:165188557-165188579 TTTTTTTTTCTTGAAACAACAGG - Intergenic
916647799 1:166804357-166804379 GTTGCTTTCCTTGAATTGACAGG + Intergenic
917178950 1:172272002-172272024 GTTGTTTTCCTTTAAATGACAGG + Intronic
917466816 1:175286469-175286491 ATTGTTTTCCTTGAAGTGACAGG + Intergenic
918001167 1:180498296-180498318 GTTGTTTTCCTTGAAGTGACAGG + Intronic
918443103 1:184588212-184588234 GTTATTTTTCTTGAAGTGTCAGG - Intronic
918769675 1:188539901-188539923 TTTTTTTTTCTTTAAAAGACAGG + Intergenic
919492546 1:198223656-198223678 GTTGTTTTCCTTTAAAGGATAGG - Intronic
921357665 1:214301663-214301685 GTTGTTTTCCTGGAAGTGACAGG + Intronic
921431748 1:215073858-215073880 GTTATTATTCTTGACAGGACAGG + Intronic
921744710 1:218726507-218726529 GTTGTTCTCCTTGAAGTGACTGG + Intergenic
922323245 1:224505945-224505967 GTTATTTCTCTTGAAATGATTGG + Intronic
922392122 1:225155646-225155668 CTTGATTTTCTTCAAATGACAGG + Intronic
922601699 1:226860458-226860480 GTTGTTTCCCTTGAAGTGACAGG - Intergenic
923707310 1:236354565-236354587 GTGGTTTTTCTTGTAGCCACAGG - Intronic
924059311 1:240155060-240155082 TTTGTATTTCTTGTAAAGACAGG + Intronic
1063289575 10:4731415-4731437 GTTGTTTTCCTTGAAGTGACAGG + Intergenic
1063370546 10:5519348-5519370 GTTGTTTTCCTTGAAGTGACAGG - Intergenic
1064434049 10:15295287-15295309 GTTATTTTTCTATAAACGATAGG + Intronic
1064775832 10:18775925-18775947 AGTGTTTTTCCTGAAAAGACAGG - Intergenic
1065152503 10:22836582-22836604 GTTATTTTTCCTGAGACCACTGG + Intergenic
1065204664 10:23345057-23345079 ATTGTTTTTCTGTAAACGACTGG + Intergenic
1065294239 10:24259439-24259461 GTTGTTGTTTTTGTAAAGACAGG - Intronic
1065341903 10:24715393-24715415 GTTTTATTTCTTAAAACGAATGG - Intronic
1066629326 10:37443329-37443351 GTCATTTTCCTTGAAATGACAGG + Intergenic
1066825356 10:39565929-39565951 GTTGTTTTTATTCAAATCACAGG + Intergenic
1068206569 10:53862621-53862643 GTTGTTTTCAATGAAATGACAGG + Intronic
1068553877 10:58436128-58436150 GTTCCTTTTCTTTAAAAGACGGG - Intergenic
1069481444 10:68785946-68785968 GTTGTTGTTGTTTAAAAGACAGG + Intronic
1069713375 10:70505256-70505278 GTTGTTTTCTTTGAAGGGACAGG + Intronic
1071903339 10:90144599-90144621 CTTTTTTTTCTTGAAGTGACAGG + Intergenic
1073071291 10:100795001-100795023 GTTATTTTCCTTGAAAACACAGG + Intronic
1073853194 10:107644935-107644957 GTTATTTTTCTTCAAACAATGGG + Intergenic
1075367459 10:121905128-121905150 TTTGTTTTTCTTGTACAGACAGG - Intronic
1075965441 10:126607475-126607497 GTTGTTTTCCTTAAAGTGACAGG - Intronic
1076070846 10:127487509-127487531 GTTGCTTTCCTTGAAGTGACAGG - Intergenic
1077813514 11:5662728-5662750 CTTGTATTTCTTCAAACGAAGGG + Intergenic
1078742834 11:14083812-14083834 GTTGTTTTCCTTGAAGTGACAGG + Intronic
1079550298 11:21688198-21688220 GTTGTTTTCCTTGATGTGACAGG - Intergenic
1081252894 11:40857741-40857763 TTTGTATTTCTTGTAAAGACAGG - Intronic
1081987047 11:47313072-47313094 GTTGTTTTCCCTGAAACAACAGG - Intronic
1082016770 11:47494920-47494942 GTTGTTGTTTTTGTAAAGACAGG + Intronic
1082057721 11:47833487-47833509 TTTGTTTTCCCTGAAATGACAGG - Intronic
1082233946 11:49799807-49799829 TTTGTTTATCTTGAAATGAAGGG - Intergenic
1082808989 11:57467382-57467404 TTTTTTTTTCTTGTAAAGACAGG + Intronic
1085994584 11:81895280-81895302 ATTCTTATTCTTAAAACGACAGG - Intergenic
1086617647 11:88841635-88841657 TTTGTTTATCTTGAAATGAAGGG + Intronic
1086951963 11:92899630-92899652 CTTGTTATTCTAGAAACAACAGG + Intergenic
1087324729 11:96707732-96707754 GTTGTTTTCCTTCAAACTTCAGG + Intergenic
1087448476 11:98286287-98286309 TTTGTTTTTCTTAAAAATACAGG + Intergenic
1088549211 11:110993764-110993786 ATTGTTTTCCCTGAAATGACTGG + Intergenic
1089031604 11:115335925-115335947 ATTGTTTCTCTTAAAATGACAGG + Intronic
1090695108 11:129232450-129232472 GTTGTTTTCCTTGAAATGACTGG - Intronic
1090821871 11:130349880-130349902 GTTGTTGTTGTTGTACCGACTGG + Intergenic
1091849603 12:3684541-3684563 GCATTTTTTATTGAAACGACTGG - Intronic
1093448312 12:19286010-19286032 GTTGTTTTCCTTGAAGTGACAGG - Intronic
1093520012 12:20038446-20038468 ATTGTTTTTCTTGAAGTAACTGG + Intergenic
1095425504 12:42070523-42070545 GTTGCTTTTCTTCAAACGGTTGG + Intergenic
1096055657 12:48649280-48649302 TTTGTTTTTTTTAAAGCGACAGG + Intergenic
1096059061 12:48681337-48681359 GTCGTTTTTCTTAAAGCGAGGGG - Intronic
1096269470 12:50153109-50153131 AATGCTTTTCTTGAAATGACGGG - Intronic
1097202682 12:57292902-57292924 GTTGTTATTCTTGATACTGCGGG - Intronic
1097255519 12:57670970-57670992 GTTGCTTTCCTTGAAGCGACAGG - Intergenic
1097299918 12:58007140-58007162 TTTTTTTTTCTTTAAAAGACAGG + Intergenic
1097615797 12:61882173-61882195 GTATTTATTCTTGAAAGGACAGG + Intronic
1097981149 12:65739163-65739185 TTTCTTTTTATTGAAAAGACCGG + Intergenic
1098775863 12:74616346-74616368 GAATTTTTTCTTGAAACTACTGG + Intergenic
1098946522 12:76595442-76595464 GTTGTTTTCCTTGAAGTGACGGG + Intergenic
1099756171 12:86852504-86852526 GTTATTTTTGTTGTAAAGACAGG - Intergenic
1100622634 12:96293938-96293960 GTTCTTTTCCTTGAAATGATAGG + Intronic
1101094716 12:101325765-101325787 GTTGTTTTCCTTGAAGTGGCAGG - Intronic
1102893692 12:116581597-116581619 TTTGTTTTTCTTGTAGAGACGGG + Intergenic
1103749394 12:123149346-123149368 GCTGTTTTTCTTGTAAGGAGTGG - Intronic
1105653193 13:22403073-22403095 GTTGTTTTTGTTGGAATGTCTGG + Intergenic
1106211711 13:27654539-27654561 GTTGTTTTCCTAGAAGTGACAGG + Intronic
1106228622 13:27803966-27803988 GTTGTTTTTCTTAAAGTAACAGG - Intergenic
1106285916 13:28317964-28317986 TTTGTTTTTTTTGAAGAGACGGG + Intronic
1107503677 13:41008339-41008361 GTTGTTTTCCTTGAAGTGATGGG - Intronic
1108234310 13:48386614-48386636 GTTGTTTTCTTTGAAATGACAGG - Intronic
1108499114 13:51052983-51053005 GTTATTTTCCTTGAAGTGACAGG - Intergenic
1109356831 13:61240848-61240870 GTTGTTTTTCTTGAAGTGATGGG - Intergenic
1109550156 13:63884858-63884880 GATGTATTTCTTGAAACAATTGG - Intergenic
1110646973 13:77898292-77898314 ACTGTTTTTCTTCAAATGACTGG + Exonic
1111415561 13:87939111-87939133 GTTAATTTTCTTAAAACAACTGG - Intergenic
1112169389 13:96954670-96954692 GTTTTGTTCCTTGAAAGGACAGG + Intergenic
1112575775 13:100635232-100635254 GATGTTTTTCTTGAGAAGTCTGG - Intronic
1113553638 13:111213609-111213631 GTTGTTGTTGTTGTAACGACTGG + Intronic
1113572957 13:111371722-111371744 GTTGTTTCTCATGAAACCTCAGG + Intergenic
1114300562 14:21373115-21373137 TTTGTATTTCTTGTAAAGACAGG + Intronic
1115489776 14:33948064-33948086 TTAGTTTTTCTTGAAAACACGGG + Intronic
1116079266 14:40153076-40153098 ATTGTTTTCCTTGAAGTGACAGG + Intergenic
1118167523 14:63352334-63352356 GTTATTTTCCTTGAAGTGACAGG + Intergenic
1118388634 14:65278199-65278221 GTTGTTTTCCTTGAAGTGACAGG - Intergenic
1118649466 14:67874668-67874690 GTTGTTTTTTTTTAACCTACTGG + Intronic
1118649925 14:67880254-67880276 CTTGTTTTTCTTGAAGTGTCGGG + Intronic
1119015931 14:71054531-71054553 GTTGTTTTCCTTGAAATAACAGG + Intronic
1119076445 14:71644784-71644806 GTTGTTTTTCCTGAAGTAACAGG + Intronic
1119344005 14:73906648-73906670 GTTGTATTTCTTGTAGAGACCGG + Intronic
1119538752 14:75424986-75425008 TTTGTTTTTCTAAAAAAGACAGG - Intergenic
1120930545 14:89843970-89843992 GTTGTTTTCCTTGAAATGACAGG + Intronic
1121208856 14:92191345-92191367 CTTATTTTTCCTGAAATGACAGG + Intergenic
1121572286 14:94955965-94955987 ATTGTTTTCCTTGAAGTGACAGG + Intergenic
1122165094 14:99817143-99817165 GTTGTTTTTCCTGGAGTGACGGG + Intronic
1122397573 14:101444474-101444496 CTTGTTCCTTTTGAAACGACTGG + Intergenic
1122529099 14:102412589-102412611 CTTGTTTTCCTTGAAGTGACAGG + Intronic
1123827957 15:24101872-24101894 TTTGTTCTTCTTCAAACGTCAGG + Intergenic
1125155690 15:36582124-36582146 GTTGTTTTCCTTGAAATGACAGG + Intronic
1125675671 15:41501449-41501471 GTGGTTTTTCTGAAAGCGACAGG - Exonic
1126479178 15:49099007-49099029 TTTGTTTTTCTTGAACAGTCAGG + Intergenic
1126742889 15:51796050-51796072 GTTGGTTTTCTTAAAATGTCTGG + Intronic
1127200216 15:56638107-56638129 GTTGTTTTCCTTGATATGACAGG - Intronic
1127440157 15:58998664-58998686 TTTGTTTTTCTTGAAGTGAACGG - Intronic
1128304562 15:66589465-66589487 TTTTCTTTTCTTGAAACGAAAGG - Intronic
1128949756 15:71865237-71865259 GTTGTTTTCCTTGAAGTGACAGG + Intronic
1132911090 16:2312211-2312233 GTTGTTTTCCTTAAAAAGACAGG + Intronic
1134184915 16:12077099-12077121 GTTGTTTTATTTGTAAAGACAGG - Intronic
1134593839 16:15479099-15479121 GTTGTTTTCCTTGAAGTGACAGG - Intronic
1137383714 16:48022312-48022334 GTTGTTATTCTTGACACCAATGG + Intergenic
1138112709 16:54337365-54337387 GTTGTTTTCATGGAAAGGACTGG + Intergenic
1139829416 16:69784870-69784892 GTTGTTTTCCTTGAAGTGTCGGG - Intronic
1140667984 16:77245091-77245113 GTGGTTTTTCTTGACATGGCAGG + Intergenic
1140929728 16:79616185-79616207 GTTGGTTCTCATGAAACAACAGG - Intergenic
1140999285 16:80293070-80293092 ATTGTTTTCCTTAAAATGACAGG + Intergenic
1142166631 16:88593752-88593774 GTTGTTCTCCTTGAAGCCACAGG - Intronic
1143493825 17:7299338-7299360 TTTGTATTTTTTGAAAAGACGGG - Intergenic
1143695995 17:8618918-8618940 GTTGTTTTCTTTGAAGTGACAGG + Intronic
1146202676 17:30873695-30873717 TTTTTTTTTTTTGAAAAGACGGG + Intronic
1146388448 17:32398706-32398728 GTTGTTTTTCTTGAAGTGACAGG + Intergenic
1147707881 17:42440019-42440041 GTTTTTTTTTTTGTAAAGACAGG + Intergenic
1149457894 17:56803262-56803284 ATTGTTTTTCTTGAGGTGACAGG - Intronic
1150509492 17:65735203-65735225 GTTGTTATCCTTGAAATGCCAGG + Intronic
1151095053 17:71487564-71487586 GTTGTTTTCCTTGAAGTGACAGG - Intergenic
1151736628 17:75945780-75945802 GTTGTTTTTTTTTTAACAACTGG - Exonic
1155416031 18:25600942-25600964 GTTGATTTTCTGGAAACAATGGG + Intergenic
1155544062 18:26896791-26896813 GTTGTTATCCTGGAAATGACAGG - Intergenic
1156226423 18:35113719-35113741 TTTGTATTTTTTGAAAAGACGGG - Intronic
1156662474 18:39362438-39362460 GTTGTTTTTCATGAAATTGCTGG - Intergenic
1157454227 18:47811737-47811759 GTTGTTTTCCTTGAAATGCATGG - Exonic
1157791878 18:50539633-50539655 TTTGTATTTCTTGTAAAGACAGG - Intergenic
1157875005 18:51264568-51264590 GTTATTTTCCTTGAAGTGACAGG - Intergenic
1158337159 18:56425657-56425679 GTTGTTTCCCTTGAAGTGACAGG + Intergenic
1163772737 19:19200481-19200503 GTTGTTTTTTTAGAAGAGACAGG + Intronic
1164440839 19:28278575-28278597 GTTGTTTTACTTGGAGGGACAGG - Intergenic
1164654948 19:29913888-29913910 GTTGTTTCCCTTGAAGTGACAGG - Intergenic
1164789655 19:30965192-30965214 GTTGTTTTTCTCGGAATCACTGG + Intergenic
1165675787 19:37721358-37721380 GTAGTCTTTGTTGAAAAGACTGG + Intergenic
1166892982 19:46005693-46005715 GCTGTTTTTCTTGAAGTGACAGG + Intronic
925576088 2:5361716-5361738 TTGTTTTTTCTTGAAATGACAGG - Intergenic
925908391 2:8554013-8554035 GTTATTTTTCCTGAAGCCACAGG + Intergenic
926459667 2:13113041-13113063 TTTGTTTTAATTGAAAGGACTGG + Intergenic
927239180 2:20905150-20905172 TTAGTTTTTCTTGAAATGATGGG + Intergenic
927287218 2:21369477-21369499 ATTGTTTGTCTGGAAACAACCGG - Intergenic
927548265 2:23973968-23973990 GTTGTTTTCCTTGAAGTGCCAGG - Intronic
927581230 2:24250318-24250340 GCTGTTTTCCTTGAAGGGACAGG - Intronic
928144737 2:28762974-28762996 GTTGTTTTCCTTGAAATGACAGG + Intronic
928316080 2:30247466-30247488 GTTATTTTCCTTGAAGTGACAGG + Intronic
928323755 2:30303730-30303752 ATTATTATTCTTGAAACGAAAGG - Intronic
929237808 2:39625038-39625060 GTTGTATTTTTTGTAAAGACAGG - Intergenic
929661534 2:43790499-43790521 GTTGTTTTTCTAGAACTGGCTGG + Intronic
930016263 2:46972934-46972956 GATGTTTTTCTTCTAACAACTGG + Intronic
930432711 2:51301094-51301116 GTTGTTCTTCTTGACCAGACTGG - Intergenic
930472041 2:51829251-51829273 GTTGTTGTTGTTGTAAAGACTGG - Intergenic
930796918 2:55403134-55403156 GTTGTTTTCCCTGAAGTGACAGG + Intronic
931659706 2:64547955-64547977 TTTGTTTTTTTTGTAAAGACAGG + Intronic
933999282 2:87693144-87693166 GTGGTTTTTCTTGTAACCATAGG + Intergenic
935149413 2:100420238-100420260 TTTGTTTTTCTTGAAGTGACAGG - Intergenic
936294569 2:111257747-111257769 GTGGTTTTTCTTGTAACCATAGG - Intergenic
937636905 2:124166251-124166273 GTTGTTTTGTTTAAAACGAATGG + Intronic
939526107 2:143296357-143296379 GTTTTCTTTCTTGTAACTACAGG - Intronic
939612044 2:144323050-144323072 GTTGTTTTCCTTGAAGTGACAGG + Intronic
939826318 2:147019678-147019700 GTTGTTTTTCTTGAAATGGCAGG - Intergenic
940717319 2:157241460-157241482 TTTGATTTTCCTGAAATGACTGG - Intergenic
941403276 2:165058035-165058057 ATTGTTTTCCTTGAAGTGACAGG + Intergenic
943716123 2:191154056-191154078 GTTGTTTTCCTTAAAGTGACAGG + Intergenic
944067622 2:195635804-195635826 TTTGTTTTCCTTGAAATGGCAGG - Intronic
944187497 2:196965685-196965707 GCTGTTTTCCTTGAAGTGACAGG + Intergenic
944449318 2:199824964-199824986 TTTGTATTTCTTGTAAAGACGGG - Intronic
944641488 2:201730527-201730549 GTTGTTCTCTTTGAAATGACAGG + Intronic
944940111 2:204615626-204615648 GTTGTTATCCTTGAAGCGACAGG + Intronic
946287532 2:218716216-218716238 GTTGGTTTCCTTGAAGTGACAGG + Intronic
946613960 2:221489337-221489359 GTTCTATTTCTCGTAACGACTGG + Intronic
946630417 2:221661563-221661585 GTTTTTTTTCTTGAAAACAATGG + Intergenic
947512024 2:230764685-230764707 GTCGTTTTCCTTGAAGTGACAGG + Intronic
947579461 2:231304877-231304899 GTTGTTTTCCTTAAAGTGACAGG + Intronic
948044250 2:234930922-234930944 GTTGTGTTACTTAAAACGATGGG - Intergenic
948170998 2:235902466-235902488 ATAGTTTTTCTTGAAATGACCGG - Intronic
948337868 2:237224750-237224772 ATTGTTTTCCTTGAAGTGACAGG + Intergenic
948492682 2:238323481-238323503 ACTGTTTTTCTTGAGATGACAGG - Intronic
948561493 2:238856793-238856815 GTTGTTTTTCTGAGAACGGCAGG - Intronic
1169468177 20:5859796-5859818 GTTGTTTCTCTGAAGACGACTGG + Intronic
1172547161 20:35771150-35771172 GTTGTATTTCTTGGAGAGACGGG + Intergenic
1173355906 20:42290110-42290132 TTTCTTTTTGTTGAAAAGACTGG - Intronic
1174254497 20:49244256-49244278 GTTGTTTTTTTTTAAGAGACAGG - Intronic
1174798058 20:53539159-53539181 TTTGTATTTTTTGAAAGGACAGG + Intergenic
1175598059 20:60251352-60251374 CTTATTTTTCTTGAAAGGAAAGG + Intergenic
1176312869 21:5163127-5163149 GTTGTTTTCTTTGAAGTGACAGG - Intergenic
1176726407 21:10438355-10438377 GTTGTTTTCCTTGAAGTGACAGG + Intergenic
1176890457 21:14311801-14311823 GTTCTTTTTCTAGAAAAGAAGGG + Intergenic
1178448583 21:32669285-32669307 GTTGTTTTTCTTAAAGAGACAGG - Intronic
1178563466 21:33661122-33661144 GTTGTTTTTCTTGCAGCATCAGG + Intronic
1178748448 21:35277062-35277084 GCTGTTTTTCTTGAAGTGACAGG + Intronic
1179313743 21:40222066-40222088 GTTGTTTCCCTTGAAGTGACAGG - Intronic
1179844179 21:44098903-44098925 GTTGTTTTCTTTGAAGTGACAGG + Intronic
1180203012 21:46238400-46238422 ATTGTTTTTCTTGAAAAGACCGG - Intronic
1180287973 22:10768730-10768752 GTTGTTTTCCTTGAAGTGACAGG - Intergenic
1180612225 22:17105520-17105542 GTTGTGTTTCTTGTGATGACTGG + Intronic
1184447825 22:44561692-44561714 GTAGTTTTTTTTGTAAAGACAGG - Intergenic
1184869812 22:47229791-47229813 GTTGTTTTCCTTGCAATGACAGG + Intergenic
949115935 3:323191-323213 GTTGTTTATCTTGAAATGAATGG - Intronic
951119746 3:18911680-18911702 GTTGTTTTTCCTGAAGCCACAGG - Intergenic
951352489 3:21623468-21623490 CTTGATTTTCTTGTAAAGACTGG - Intronic
954269046 3:49493048-49493070 TTTTTTTTTTTTGAGACGACAGG + Intronic
954277519 3:49552345-49552367 TTTGTTTTTGTAGAAACCACAGG - Intergenic
955809785 3:62775581-62775603 GTTGTTTTTCTTGAAGTAACAGG + Intronic
956162402 3:66369015-66369037 TTTTTTTTTTTTGAAAAGACAGG - Intronic
956762558 3:72456728-72456750 TTTGTATTTCTTGTAAAGACGGG + Intergenic
956830766 3:73045459-73045481 GTTATTTATCTTGAAATGACAGG + Intronic
956884974 3:73550075-73550097 GTTGTTTTACTTAAAAGCACAGG + Intronic
959622894 3:108418062-108418084 GTTGCTTTCCTTGAAGTGACAGG + Intronic
960033191 3:113076160-113076182 GTTGTTTTAATTGAAGTGACAGG - Intergenic
960895427 3:122499749-122499771 TTTTTTTTTCTTGAAGAGACAGG - Intronic
962024265 3:131530568-131530590 GTTGTTTTTCTTGAAGTGACAGG - Intergenic
962150765 3:132890941-132890963 GTTGTTTTTCTTGAAGTAACAGG + Intergenic
962478602 3:135779278-135779300 GGGGTTTTTGTTGAAACTACAGG + Intergenic
963241855 3:143011976-143011998 GTTGTTTTCCTTGAAGTAACAGG - Intronic
963903012 3:150750587-150750609 TTTTTTTTTATTGAAATGACGGG + Intronic
964368772 3:155977009-155977031 GTTGTTTTCCTTGAAGTGATGGG + Intergenic
964504669 3:157386129-157386151 GTAGTTTTGCTTGAAATGAAAGG + Intronic
965859009 3:173124592-173124614 GTTGTTTTTCTTAAAAGAAAAGG - Intronic
966517246 3:180831429-180831451 GTTGTTTTTCTTGAAACGACAGG - Intronic
966710290 3:182965652-182965674 GTTGTCTTTCTCAAAATGACTGG - Exonic
966857352 3:184204138-184204160 TTTGTATTTTTTGAAAAGACGGG + Intronic
968856021 4:3122912-3122934 TTTTGTTTTCTTGAAAGGACAGG - Exonic
969157802 4:5227571-5227593 GATATTTTTCTTGAAATGACAGG + Intronic
969730395 4:8952924-8952946 GTTGTATTTCTAGAAGAGACTGG + Intergenic
971774694 4:30947277-30947299 GTTTTTTTTCCCAAAACGACAGG - Intronic
972126296 4:35771144-35771166 TTTGTTTTTTTTGAGACGAAGGG + Intergenic
972649033 4:40998071-40998093 GTTGTTTTCCTTGAAGTGACAGG - Intronic
973015127 4:45128576-45128598 GTTGTTTCTCCTGGAACAACTGG - Intergenic
973665736 4:53156998-53157020 GTTGTTTTCCTTGAAGGAACAGG - Intronic
974800895 4:66816485-66816507 GTTGTTTTTCTTATAATGACAGG + Intergenic
974919576 4:68222225-68222247 TTTGTTTTTCTTGTAGAGACAGG - Intergenic
975273839 4:72471137-72471159 GTTGTTTTCCTTGAAAAGGCAGG - Intronic
975338919 4:73215109-73215131 ATTGTTTTTCTTGAAATGACAGG - Intronic
975708776 4:77137822-77137844 GTTTTTTTCCTTGAAGTGACAGG - Intergenic
977751069 4:100609719-100609741 GTTGTTCTTCTGGAAACATCTGG + Intronic
977923917 4:102677233-102677255 GTTGTTTTTCTTGAAATGATAGG - Intronic
979469413 4:121076387-121076409 TTTGTTTGCCTTGAAATGACAGG - Intergenic
980386878 4:132097899-132097921 CTTGATTTTCTTTAAACGAGTGG - Intergenic
980808571 4:137845513-137845535 GTTATTTTCCTTGAAGTGACAGG - Intergenic
981510887 4:145556981-145557003 GATGTATTTCTTAAAACTACGGG + Intronic
982910972 4:161142941-161142963 TTTTTTTTTATTGAAAAGACAGG + Intergenic
983568258 4:169176937-169176959 GTTGTTGTTGTTGTAAAGACAGG + Intronic
983610905 4:169643902-169643924 GTTGTTTTACTTGAAAAGACAGG + Intronic
983722017 4:170866751-170866773 GTTGCTTTTAGTGAAATGACAGG - Intergenic
983913141 4:173262580-173262602 GTTGTTTTTGTTGAAGTGACAGG + Intronic
984677931 4:182571352-182571374 TTTGTTTTTTTTGAAAAGACAGG - Intronic
985069783 4:186156796-186156818 TTTGTATTTTTTGAAAAGACAGG - Intronic
985134387 4:186770747-186770769 GTTATTTTCCTTGAAGCAACAGG - Intergenic
986108413 5:4685094-4685116 GTTGTTTTCCTTGAAGTGTCAGG + Intergenic
986148359 5:5102475-5102497 ATTCTTTTTCTTTAAAGGACAGG - Intergenic
986357129 5:6939755-6939777 GTTGTTTTTTTTGTAGAGACGGG + Intergenic
986924848 5:12734269-12734291 GGTCTTTTTTTTGAAAAGACAGG - Intergenic
987086818 5:14477972-14477994 GTTGTTTGCCTTGAAATGACAGG + Intronic
988859557 5:35263295-35263317 GTTGTTTTTCTTGACCTGGCAGG + Intergenic
990119484 5:52432447-52432469 GTTGCTTTCCTTGAAGTGACAGG + Intergenic
990156123 5:52879244-52879266 GTTGTTTTTCTTGAAAATTTTGG - Intronic
990337809 5:54792470-54792492 TTTGTATTTCTTGAAGAGACAGG + Intergenic
991376731 5:65975637-65975659 ACTGTTTTTCTTGAAATGATGGG + Intronic
991692489 5:69238456-69238478 GTTGTTCTTCTTGTAGAGACAGG + Intronic
992149153 5:73884845-73884867 GTTGTTATTCTTTAAAATACTGG - Intronic
992864869 5:80947990-80948012 CTTCTTTTTCTTGAAAAGACAGG - Intergenic
992900163 5:81286701-81286723 GTTTTTTCTCTTGGAACTACAGG - Intergenic
993390172 5:87311243-87311265 GTTTTTTTCCTTGAAGTGACAGG - Intronic
993702495 5:91135008-91135030 TTTGTTTTTCTTGTAGAGACGGG - Intronic
994144635 5:96380593-96380615 GTTGTTTTCCTTGAAGTGACAGG - Intergenic
994972494 5:106759259-106759281 GTTATTCTTCTTCAAACGAATGG - Intergenic
995627940 5:114099469-114099491 TTTATTTTTCTTGAAAAGACAGG + Intergenic
995886837 5:116904311-116904333 GCTGTTTTCCTTGAAATGATAGG - Intergenic
995958786 5:117813779-117813801 GTTGTTTTTCTTTAAACGGCAGG - Intergenic
997378108 5:133412622-133412644 GTTCTTTTTCTTTAAATGAATGG - Intronic
998147298 5:139737213-139737235 GTTGTTTTCCTTGAAGTGACTGG + Intergenic
998219456 5:140264663-140264685 GTTTTTTTTTTTGTAAAGACAGG - Intronic
998224637 5:140317180-140317202 TTTGTATTTCTTGTAAAGACAGG - Intergenic
999084563 5:148875725-148875747 GTGATTTTTCTTGAAGCGACAGG - Intergenic
1000686901 5:164261794-164261816 TTTTTTTTTCTTGAAACCACAGG - Intergenic
1001167919 5:169388132-169388154 GTCGCTTTCCTTGAAACGACAGG + Intergenic
1001630639 5:173172717-173172739 TTTTTTTTTTTTGAAAAGACGGG + Intergenic
1002154282 5:177263813-177263835 GTTCTTTTTCTTGAATTGATAGG - Intronic
1002203319 5:177544507-177544529 GTTGTTTTCCTTGAAGTGACAGG - Intronic
1003002832 6:2351864-2351886 GTTATTTTTCTTGAAATGAATGG - Intergenic
1003169367 6:3709040-3709062 TTTGCTTTTCTTGAAAAGAGTGG - Intergenic
1003435974 6:6088421-6088443 GTTGTTTTTCTGGAATAGAATGG + Intergenic
1004065963 6:12244503-12244525 GTTATTTTCCTTGAAGTGACAGG + Intergenic
1004820557 6:19363828-19363850 TTTTTTTTTCTTGAAACTAAAGG - Intergenic
1005591546 6:27333756-27333778 GTTGTTTTCCTTGAAGTGGCAGG - Intergenic
1006537611 6:34712362-34712384 GTTGTTTTTCTTGAGACAAACGG - Intergenic
1007506795 6:42341719-42341741 ATTTTTTTTCGTGAAACAACTGG - Intronic
1008168609 6:48172934-48172956 ATTGTTTTCCTTGAAATGGCAGG - Intergenic
1009742350 6:67762323-67762345 TTCGTTTTTCTTTAAATGACTGG - Intergenic
1009816459 6:68742484-68742506 GTTGTTATAGTTGAAAGGACAGG + Intronic
1011481006 6:87793642-87793664 GTTGTTTTTCTTGAAGTGACAGG - Intergenic
1011673132 6:89703703-89703725 ATTGTTTTTCTTGAAGTGACAGG - Intronic
1011716464 6:90110650-90110672 GTTGTTTTTCTTGAAGTATCAGG + Intronic
1012409469 6:98939605-98939627 TTCGTTTATCTTGAAATGACAGG + Intronic
1013039201 6:106417164-106417186 GTTATTTTTTTTTAAAAGACAGG + Intergenic
1013402156 6:109808727-109808749 ATTGTTTTTCTTGAAGTGACAGG - Intronic
1013639884 6:112063672-112063694 GTTGTTTTCCTTGAAGTGACAGG + Intronic
1013867638 6:114718142-114718164 TTTTTTTTTCTTGTAAAGACAGG - Intergenic
1014590660 6:123263621-123263643 GTTGTTGTTCTTTTAAAGACAGG - Intronic
1015224894 6:130846031-130846053 ATTGTTTCTCTTGAGGCGACAGG - Intronic
1015974044 6:138771467-138771489 TTTGTATTTCTTGTAAAGACAGG + Intronic
1016565717 6:145451048-145451070 GTTGCTTTTCTTGAAGTGAGAGG - Intergenic
1016636447 6:146297584-146297606 TTTGTTTTTCTTCAAATGGCAGG + Intronic
1016790652 6:148064259-148064281 TTTGTTTTTCTTTTAACGTCAGG + Intergenic
1017622401 6:156312828-156312850 GTTGTTTTACTAGAAGTGACAGG + Intergenic
1018894940 6:168007771-168007793 GTGGTTTTTCTTGTAGCCACAGG + Intronic
1021882479 7:25108095-25108117 GTCCTTTTTCTTGAAATGCCAGG - Intergenic
1022089412 7:27097828-27097850 GTTTTTTCTCTTGAGAGGACAGG - Intergenic
1023326307 7:39061765-39061787 GTTGTTTTCTTTGAAGTGACAGG + Intronic
1023577458 7:41643812-41643834 GTTGTTTTCCTTGAAGTGACAGG - Intergenic
1024034761 7:45497801-45497823 ATTGTTTTTCTAGAAACTATGGG - Intergenic
1024535606 7:50428763-50428785 GTTGTTCTGCTTGAAGTGACAGG + Intergenic
1025158634 7:56633684-56633706 TTTGTTTTTCTTGTAACTACAGG - Intergenic
1025727975 7:64084572-64084594 TTTGTTTTTCTTGTAACTACAGG + Intronic
1026051983 7:66954566-66954588 TTTGTATTTTTTGAAAAGACAGG + Intronic
1026662921 7:72317743-72317765 GTTCTTTTTCTTAGAAAGACTGG - Intronic
1027643265 7:80764722-80764744 GTCGTTTTTCTTGAAATTACTGG + Intronic
1027683037 7:81243888-81243910 GTTGTTTTCCCTGAAAAGACAGG - Intergenic
1028695262 7:93703062-93703084 GTTTGTTTCCTTGAAATGACAGG - Intronic
1031909828 7:127504195-127504217 GTTGTTTTCCTTGAAGTTACAGG - Intergenic
1033143140 7:138845835-138845857 GTTGTTTTTCTTGAAGTGACAGG + Intronic
1033372637 7:140724984-140725006 GTTGTTTTTATAGAAAGAACTGG - Intronic
1034524771 7:151651019-151651041 GTTGTTTTCCTTGCAGTGACAGG - Intronic
1034586660 7:152099768-152099790 TTTTTTTTTTTTGAAAAGACAGG + Intronic
1034603698 7:152289613-152289635 GTTGTTTTCCTTGAAGTGACAGG - Intronic
1034646410 7:152651683-152651705 TTTGTATTTCTTGTAAAGACTGG + Intronic
1036928829 8:12932681-12932703 GTTGTTTTCTTTGAAGCAACAGG - Intergenic
1038985798 8:32808644-32808666 GTTTTTGTTCTTGAAACTGCTGG + Intergenic
1040372522 8:46790849-46790871 TTTGTTTTTCTTGTAACTCCAGG + Intergenic
1040817048 8:51519803-51519825 CTTGTTTTTATTGTAAGGACAGG - Intronic
1042251482 8:66760283-66760305 GTTGTTTTCCTTGATGTGACAGG + Intronic
1042538274 8:69881242-69881264 GTTGATTTTCTTGAAAAGATAGG - Intergenic
1043955452 8:86353828-86353850 GTTGTTTTTCCTCAAAAGAAAGG - Intronic
1044690615 8:94873757-94873779 GTTTTTGTTTTTGAAAGGACAGG - Intronic
1045087675 8:98704211-98704233 TTTGTTTTCCTTGAAATGACAGG - Intronic
1045219139 8:100179968-100179990 GTTGTTTTTCTTAAAGCGACAGG - Intronic
1045765831 8:105667137-105667159 ATTGTTTTCCTTGAAGCGATAGG - Intronic
1046734320 8:117760334-117760356 GTTGTTTTCCTTGAAGTGACAGG - Intergenic
1046850469 8:118966678-118966700 GTTTTTTTTTTTTAAATGACTGG + Intergenic
1048208316 8:132433288-132433310 GTTGTTTTTCATGAACAGAATGG - Intronic
1048569107 8:135636032-135636054 GTTGTTTTACTTAAAGTGACAGG + Intronic
1048663618 8:136635094-136635116 GTTGTTGTTCTTAAAAGGAATGG - Intergenic
1049978179 9:880056-880078 GTTGTTTTCCTTGAAGTGACAGG + Intronic
1051076049 9:13237669-13237691 GTTGTCTTCCTTGAAGTGACAGG - Intronic
1051435794 9:17030039-17030061 GTTGTTTACCTTAAAATGACAGG + Intergenic
1051608032 9:18935797-18935819 ATTGTTTTTATTGAAACTCCTGG + Intronic
1051725547 9:20084951-20084973 GTAGTTTTTCTGCAAAAGACAGG + Intergenic
1051805258 9:20985465-20985487 GGTATTTTTCTTGAAGTGACAGG + Intronic
1055371926 9:75609072-75609094 GTTGTTTTCCTTGAAGGGACAGG - Intergenic
1056421078 9:86426775-86426797 TTTTTTTTTTTTGAAAAGACAGG + Intergenic
1058221228 9:102305621-102305643 TTTGTTTTTCTTGTAACTACAGG + Intergenic
1058917607 9:109582678-109582700 GTTGTTTTTCTTGAAATGACAGG - Intergenic
1060071268 9:120550101-120550123 CTTGGCTTTCTTGAAAAGACAGG - Intronic
1061273494 9:129557256-129557278 GTTGTTTTTCTGGAAGGGAGCGG - Intergenic
1187553552 X:20329669-20329691 GTTGTTTTCCTTGAAGAGACAGG - Intergenic
1189942553 X:46140286-46140308 GTTGTTTTCCTTGAAGTGACAGG + Intergenic
1190433870 X:50404374-50404396 ATTTTTCTTTTTGAAACGACTGG - Intronic
1192551500 X:72058209-72058231 GCTGTTTTCCTTGAAGCAACAGG - Intergenic
1194491703 X:94558489-94558511 GTTGTTTTTCTTAACAAGCCTGG - Intergenic
1194832362 X:98639408-98639430 GTTGTTTTGCTTGATGCTACAGG - Intergenic
1195052690 X:101112117-101112139 GTTGTTTTCTTTGAAATAACAGG - Intronic
1195616055 X:106912789-106912811 GTTGTTTTCCTTGAGGTGACAGG - Intronic
1195747547 X:108134039-108134061 TTTTTTTTTCTTAAAAAGACTGG + Exonic
1197197938 X:123722055-123722077 GTTGTTTTCCTTGAAGTGACAGG - Intronic
1198121664 X:133599028-133599050 GTTGTTTTCCCTGAACTGACAGG + Intronic
1198132674 X:133713709-133713731 GTTGTTTTCCTTGAAGTAACAGG - Intronic
1199676345 X:150192947-150192969 GTTGTTTTCCTTGAAGTGACAGG + Intergenic
1199839136 X:151626170-151626192 CTTTTTTTTCTTGAAAAGAAAGG + Intronic
1200692041 Y:6316044-6316066 GTTATTTCTCATGAAACCACAGG - Intergenic
1200713674 Y:6512899-6512921 GTTATTTCTCATGAAACCACAGG + Intergenic
1200832579 Y:7701829-7701851 GTTATTTCTCATGAAACCACAGG - Intergenic
1201043231 Y:9858683-9858705 GTTATTTCTCATGAAACCACAGG + Intergenic
1202114382 Y:21456337-21456359 GTTATTTCTCATGAAACCACAGG + Intergenic
1202389304 Y:24353737-24353759 GTTCTATTTCTTGAAAGGAAAGG + Intergenic
1202481483 Y:25316387-25316409 GTTCTATTTCTTGAAAGGAAAGG - Intergenic