ID: 966519385

View in Genome Browser
Species Human (GRCh38)
Location 3:180856079-180856101
Sequence TGGTGGGACTAGAATTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966519385_966519389 26 Left 966519385 3:180856079-180856101 CCTCTGCAATTCTAGTCCCACCA 0: 1
1: 0
2: 0
3: 7
4: 126
Right 966519389 3:180856128-180856150 AGCATATCACTGCTACAACCAGG 0: 1
1: 0
2: 1
3: 8
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966519385 Original CRISPR TGGTGGGACTAGAATTGCAG AGG (reversed) Intronic
901430226 1:9209621-9209643 TGAAGGGGGTAGAATTGCAGAGG - Intergenic
901684966 1:10938761-10938783 TGGGGGGTCCAGTATTGCAGAGG - Intergenic
904475790 1:30763894-30763916 TGGTGGCCCTAGAACAGCAGGGG - Intergenic
905086290 1:35380692-35380714 TGGTGGGATTAGGGTTGGAGTGG + Intronic
906071325 1:43018871-43018893 TGGTAGGTCCAGAATTCCAGTGG + Intergenic
913670424 1:121093129-121093151 TGGTGAGGTTAGAATTCCAGTGG - Exonic
914022191 1:143880570-143880592 TGGTGAGGTTAGAATTCCAGTGG - Intergenic
914660676 1:149788499-149788521 TGGTGAGGTTAGAATTCCAGTGG - Exonic
915098355 1:153480206-153480228 GGGTGGGACTAGGTTTGGAGTGG - Intergenic
916128375 1:161591050-161591072 TGGTGGGACATGATGTGCAGAGG - Intronic
916138294 1:161672881-161672903 TGGTGGGACACGATGTGCAGAGG - Intronic
916955956 1:169835036-169835058 TGGTGGGACTAGAGAAGCAAAGG + Intronic
917379116 1:174383918-174383940 CAGTGGGACTGGAATTGCTGGGG - Intronic
919467577 1:197940813-197940835 GGATTGGACTAGAATTACAGTGG - Intergenic
920218063 1:204375499-204375521 TGGTGAGAATAGAAGTGAAGGGG - Intronic
921945801 1:220885150-220885172 TGGTGGGGCTGGAGTTTCAGGGG + Intergenic
1066166107 10:32789833-32789855 TGGTGGGACAAGAATAGAATAGG + Intronic
1068557775 10:58478063-58478085 TGATAGGACTAGTCTTGCAGTGG - Intergenic
1070172989 10:73946704-73946726 TTGTGGGGCTGGAATTACAGTGG + Intergenic
1071359650 10:84833400-84833422 TGGTGGGACTGGAATAGGATAGG - Intergenic
1078784531 11:14475801-14475823 TGGTGGGTCTAGAACTGCTAAGG + Exonic
1079408539 11:20165548-20165570 TGGTGGGACAAGAACTGGCGAGG - Intergenic
1079787425 11:24691498-24691520 TGGTGGGTCTTGAAATACAGGGG - Intronic
1081737831 11:45416691-45416713 TGGTGGGACTTGGATCACAGAGG - Intergenic
1084092296 11:66886574-66886596 TGGTGGGAATAGGAATGAAGAGG + Intronic
1085757408 11:79213144-79213166 TGGTGGGAGGAGAAAGGCAGTGG + Intronic
1088219730 11:107556536-107556558 TGGTGGGACTAGCTTTGTAAAGG + Intronic
1088260260 11:107936965-107936987 TGGTGGGTCCATAATTGCATAGG + Intronic
1093460311 12:19402028-19402050 TTGTGGGGCTGGAATAGCAGAGG + Intergenic
1097484396 12:60176994-60177016 TTGTGGGTATAGAATTGCTGAGG - Intergenic
1098036933 12:66312996-66313018 TGGTAGCACTAGAAATACAGTGG + Intronic
1101851858 12:108409673-108409695 TGGTGGGAAGAGAATAGCTGTGG + Intergenic
1105970095 13:25421177-25421199 TAGTGGTCCTAGCATTGCAGTGG + Intronic
1112720036 13:102233472-102233494 TGGTGGAACTTGCATTCCAGTGG - Intronic
1113321212 13:109234446-109234468 TAGTGGCAATAGAATTGCAAAGG + Intergenic
1114250300 14:20954262-20954284 AGGTGGGAAGTGAATTGCAGTGG - Intergenic
1123778753 15:23605159-23605181 TGGTGGGCCAAGACCTGCAGAGG - Intronic
1124114237 15:26826383-26826405 TGGTGTTACTAGACTTGCAATGG - Intronic
1126024391 15:44432106-44432128 TGGTGGGGATAGAATTGTGGTGG + Intronic
1128848107 15:70919630-70919652 TGGTGGGAAAAGCATTGCACAGG + Intronic
1129205690 15:74035866-74035888 TGGTGGGAATGTAATTGGAGAGG - Intronic
1130140508 15:81222162-81222184 TGGTGGGACAAGAATGCGAGAGG + Intronic
1132445423 15:101912971-101912993 TGGTACCACTACAATTGCAGTGG + Intergenic
1132690621 16:1180448-1180470 TGGTGGGACTGGAGGTGCCGTGG + Intronic
1133819381 16:9222977-9222999 TGGTGGGGCTGGAAGGGCAGGGG + Intergenic
1138116194 16:54362489-54362511 TGGTGGGAAAAGGATTGCTGCGG - Intergenic
1140345982 16:74213483-74213505 TGGTGACATTAGAATTTCAGTGG + Intergenic
1144064512 17:11612483-11612505 TGGAGGGACCTGAATTCCAGAGG - Intronic
1145978407 17:28997493-28997515 AGGTGAGACTAGCAATGCAGAGG - Intronic
1149100482 17:52900553-52900575 TGGTGGGAATAGAATCGGGGAGG + Intergenic
1154968633 18:21384654-21384676 TGGTCTGTTTAGAATTGCAGAGG + Intronic
1155022970 18:21913195-21913217 TGGTGGGGATAGAAATGCAGGGG + Intergenic
1158310960 18:56157778-56157800 TTGTGAGGCTAGAACTGCAGGGG - Intergenic
1160639885 19:120736-120758 TGGTACCACTACAATTGCAGTGG - Intergenic
1161115172 19:2492794-2492816 TGGTGGGATTAGAACTGCACAGG + Intergenic
1161352490 19:3801688-3801710 TGGTGGGACGAGGGTTGCGGAGG + Exonic
1165970597 19:39625645-39625667 CTGTGGCACTAGAATTGTAGGGG - Intergenic
928466951 2:31531217-31531239 TGATGGGACTGGGTTTGCAGGGG + Intronic
929485031 2:42345587-42345609 TGGTGGGACAAGAATGGCTGAGG + Intronic
929644073 2:43609968-43609990 TGGTGGAAAAAGAAGTGCAGAGG - Intergenic
930103055 2:47617905-47617927 TGTTGGGAGTAGAATTGAGGGGG - Intergenic
933720202 2:85392783-85392805 TGGCAGGAGTTGAATTGCAGGGG + Intergenic
934619689 2:95796618-95796640 TGGTGGGAGCAGAAGAGCAGAGG + Intergenic
934641199 2:96027939-96027961 TGGTGGGAGCAGAAGAGCAGAGG - Intronic
935468074 2:103423246-103423268 TGGTGTTACTACAAATGCAGGGG + Intergenic
937983771 2:127629485-127629507 TGGTGGGACTGGAACCTCAGGGG - Intronic
938694584 2:133823702-133823724 TGGTGTGAACAGAACTGCAGTGG - Intergenic
939537263 2:143447425-143447447 TGGTGAGACCAGACTTTCAGTGG - Intronic
940837111 2:158535135-158535157 TGGTGCCACAAAAATTGCAGGGG - Intronic
942598729 2:177618582-177618604 TGCTGGGCCGAGAACTGCAGCGG - Exonic
944567211 2:201003442-201003464 TGCTGGGATTACAAGTGCAGTGG - Intronic
945165651 2:206940810-206940832 TTGTGGGACAAAAATTGGAGTGG - Intronic
945936891 2:215911727-215911749 TGGAAGGGCTAGAATCGCAGTGG - Intergenic
946000355 2:216477010-216477032 TGGTGGGACTGGAAATGGGGTGG + Intronic
1172813633 20:37669582-37669604 TGGGGGGACTTGAATGTCAGAGG + Intergenic
1173257075 20:41401419-41401441 TGGGGGAACTAGATTTGCATAGG - Intergenic
1174104885 20:48155141-48155163 TGGTGGGACCAGGAATGCAGGGG - Intergenic
1178031896 21:28537333-28537355 TGGTGAGTCTAGAGTTGCTGAGG + Intergenic
1185053466 22:48565749-48565771 TTATGGGACTAGAATTGCCTTGG + Intronic
955153663 3:56393973-56393995 TGGATGGAGTAAAATTGCAGGGG - Intronic
956181566 3:66522537-66522559 TGGCTGAAATAGAATTGCAGAGG - Intergenic
965722392 3:171676303-171676325 GGATGGGACTGGAATTGCACTGG - Intronic
966519385 3:180856079-180856101 TGGTGGGACTAGAATTGCAGAGG - Intronic
968008589 3:195259158-195259180 TGGTGGGACTAGTCTCCCAGAGG - Intronic
968327380 3:197830522-197830544 TGGACGAACAAGAATTGCAGAGG + Intronic
970939033 4:21609564-21609586 TGCTAGGACTAGATTTGAAGGGG + Intronic
972213036 4:36861853-36861875 CTGTGGGACCAGAATGGCAGAGG + Intergenic
974725964 4:65798843-65798865 GGCTGGGCCTAGAATTGGAGTGG + Intergenic
978422195 4:108544531-108544553 TAGTGGAACAAGAACTGCAGAGG + Intergenic
979664153 4:123292722-123292744 TCGTGGGGCTGGAATGGCAGAGG + Intronic
979973052 4:127161525-127161547 TTTTGGGTCTAGCATTGCAGAGG - Intergenic
984641037 4:182164431-182164453 AGCTTGGACTAGAATGGCAGGGG - Intronic
987486194 5:18530476-18530498 AGGTGGGACTAGCATGGCAATGG - Intergenic
989610245 5:43283948-43283970 TGATGAGACTAGAATGGTAGAGG - Intergenic
993289316 5:86044057-86044079 TAGTGGGTCTAGAACTTCAGAGG + Intergenic
995314710 5:110755638-110755660 TGGTGGGACTATAACTTCAAAGG + Intronic
1001772195 5:174304947-174304969 AGGTGGGACATGAAATGCAGGGG + Intergenic
1002747235 6:69143-69165 TGGTACCACTACAATTGCAGTGG - Intergenic
1003160291 6:3628645-3628667 TGGTGGGGCTTGAGTGGCAGCGG - Intergenic
1003382695 6:5639312-5639334 TGATGGGACTTGAAATGCAAAGG - Intronic
1004765203 6:18718759-18718781 TGGGGGGAGTAGAATTGGAGTGG - Intergenic
1009025419 6:57993457-57993479 TGGTATGATTAGAGTTGCAGTGG - Intergenic
1009200981 6:60744905-60744927 TGGTATGATTAGAGTTGCAGTGG - Intergenic
1012034910 6:94122829-94122851 TGCTGGGACTAGAACTGGATAGG - Intergenic
1012086406 6:94831461-94831483 TGGTGGGAATAGAATTGGTGAGG - Intergenic
1012377332 6:98578288-98578310 TGGTGGGAGAAGACATGCAGTGG + Intergenic
1016540276 6:145156849-145156871 TGGAGGGACTAAAACTGAAGGGG + Intergenic
1016566572 6:145461809-145461831 TGCTGGGACAATAATTTCAGAGG + Intergenic
1017712996 6:157186538-157186560 TGATGGGACTGGAATCGGAGAGG - Intronic
1021606611 7:22414901-22414923 GGGTGGGGCTAGCCTTGCAGTGG + Intergenic
1034220318 7:149439504-149439526 TGGTGGGTTTAAAATTGCCGGGG - Intronic
1034905784 7:154944550-154944572 TGGACGGTTTAGAATTGCAGAGG - Exonic
1035647093 8:1232919-1232941 GGGTGGGCCTAGAATGGGAGTGG - Intergenic
1037718861 8:21423950-21423972 TGATGGTACTAGATTTACAGAGG + Intergenic
1041885091 8:62799097-62799119 TGTTGGGACTGGAAATGGAGGGG + Intronic
1042909888 8:73815678-73815700 TGTTCAGACTAGAGTTGCAGAGG + Intronic
1044291459 8:90475577-90475599 TGGAGGGACTAGAAATACAAAGG + Intergenic
1044626577 8:94240142-94240164 GGGAGAGCCTAGAATTGCAGAGG + Intergenic
1048329011 8:133459706-133459728 TGCTGGGGCTGGAAATGCAGAGG + Exonic
1049420822 8:142515786-142515808 TGATGGGACTTCAATTCCAGAGG + Intronic
1049946076 9:597306-597328 TGGTGGGACTAGAAATGGTTTGG - Intronic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1055167050 9:73209675-73209697 TGGTGGCTCAAGATTTGCAGAGG + Intergenic
1055916121 9:81401972-81401994 TGGAGGGACTAAATTTGCTGGGG + Intergenic
1059008434 9:110429820-110429842 GGGTGGGAAAATAATTGCAGAGG - Intronic
1059756178 9:117295847-117295869 TGGTGGTAGGAGCATTGCAGAGG + Intronic
1060950052 9:127595820-127595842 TGGTGGGACTTGGGTTACAGAGG - Intergenic
1061659929 9:132122766-132122788 TGCTGGGACTACACATGCAGGGG - Intergenic
1189910660 X:45807290-45807312 TGCTTGTACTAGAATTTCAGTGG + Intergenic
1195944208 X:110191944-110191966 TGGTGGGACTAGATTCTCATAGG - Intergenic
1196666530 X:118323062-118323084 TGGTGGTAGCAGTATTGCAGTGG - Intergenic
1197149151 X:123201402-123201424 TGGTAGGACTGGAGATGCAGAGG + Intronic
1201849585 Y:18463230-18463252 TGGAGAGACAAGAATTGAAGAGG - Intergenic
1201883733 Y:18857145-18857167 TGGAGAGACAAGAATTGAAGAGG + Intergenic