ID: 966531885

View in Genome Browser
Species Human (GRCh38)
Location 3:180989965-180989987
Sequence GGAAAAAATCGGTCTGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966531885 Original CRISPR GGAAAAAATCGGTCTGAGTA AGG (reversed) Intergenic
902849838 1:19146094-19146116 GGAAAAAAACAGTCTGGGAAAGG + Intronic
906366685 1:45216092-45216114 GGAAAAACTCCGTCTTAGTAAGG - Intronic
911388226 1:97204680-97204702 TGAAAAAAACCCTCTGAGTAAGG - Intronic
912006695 1:104911852-104911874 AAAAAAAATTGATCTGAGTAAGG + Intergenic
918140917 1:181719036-181719058 GGAACATATGGTTCTGAGTACGG + Intronic
920024806 1:202986509-202986531 GGAAGAATTGGGTCTGAGAATGG - Intergenic
920731099 1:208485831-208485853 GTAAAAAATCTCTCTGAGAAAGG - Intergenic
1063963381 10:11325806-11325828 GGAAAAAAAAAGTCAGAGTAAGG - Intronic
1065102701 10:22346115-22346137 GGATAAAATGGGTCTCATTAGGG - Intronic
1066534887 10:36380857-36380879 GGAACAATTCTGTCTGATTAGGG - Intergenic
1066642623 10:37571371-37571393 GGAACAATTCTGTCTGATTAGGG - Intergenic
1067720728 10:48725810-48725832 GGAACAAATCCATCTGAGGAAGG + Intronic
1072183543 10:93011975-93011997 AGAAAAAAGGGGTCTGAGAATGG + Intronic
1073866676 10:107812657-107812679 GGAAAAAAAAGGTCTGAATGTGG + Intergenic
1077518455 11:3016575-3016597 GAAAGAAATAGCTCTGAGTAAGG + Intronic
1080802933 11:35625421-35625443 GGAAAAAATCACTATGAGGAAGG - Intergenic
1081067102 11:38557381-38557403 GGTAAAAAGCAGTCTGAGTCTGG + Intergenic
1081748889 11:45493699-45493721 GGAAAAAATAGATCAGAATAAGG - Intergenic
1082244596 11:49906524-49906546 GGAAAACATCTGGCTGAGCATGG - Intergenic
1083663030 11:64260610-64260632 AGAAAAAATCAGTCTGAGCTGGG + Intronic
1090197797 11:124831798-124831820 GGAAAATAAAGGTCTGAGAAGGG - Intergenic
1093692015 12:22119579-22119601 GGACAAAAGTGGTCAGAGTAGGG - Intronic
1096722125 12:53531128-53531150 GGAAAAAATGGGGCTGGGCATGG + Intronic
1099120498 12:78683957-78683979 GGAAATAATAGCTCTGAGTACGG + Intergenic
1100435888 12:94571185-94571207 GCAGGAAATCGGTCTGATTAAGG + Exonic
1101718822 12:107333836-107333858 GGAAAAAATAAATCAGAGTAAGG + Intronic
1103811340 12:123616478-123616500 AGAAAAAAGCATTCTGAGTAAGG - Intronic
1114817502 14:25977956-25977978 GGTAAAAGTTGGTGTGAGTATGG - Intergenic
1117988245 14:61409339-61409361 TGAAAGAATCGGCCAGAGTAGGG - Intronic
1127212464 15:56787754-56787776 GGAAAAATTCAGTCTGGGCACGG - Intronic
1127507181 15:59608815-59608837 GGAAAAAATCAGTATACGTAGGG + Intronic
1128494685 15:68188646-68188668 GGAATAAAGCTGTCTGGGTAAGG + Exonic
1129546338 15:76399712-76399734 GGTAAAAATTTGGCTGAGTAAGG + Intronic
1130289272 15:82582636-82582658 TGATAAAACAGGTCTGAGTAGGG - Intronic
1130601420 15:85277159-85277181 GGAAAAAAACGGTTTCAGTGAGG + Intergenic
1132077208 15:98831822-98831844 TGAAAAAGTCTGTCTGGGTATGG + Intronic
1132857823 16:2054891-2054913 GGAAGAGATCGGTCTGACTCTGG + Intronic
1134013074 16:10869496-10869518 GGAAAAAATCAATCTGGGGAGGG - Intergenic
1148941881 17:51221664-51221686 AGAAAAAAACGGTCTGTGTATGG - Intronic
1149824462 17:59814988-59815010 GAAAAAAATCGGTGTGTGTGTGG - Intronic
1150080865 17:62237142-62237164 GAAAAAAATCAGTTTGACTAAGG - Intergenic
1168522630 19:57064706-57064728 GGAAAGGATGGGACTGAGTATGG - Intergenic
926074878 2:9934496-9934518 GGAAAAAAGCAAACTGAGTAAGG + Intergenic
933796248 2:85922194-85922216 GGGAAAAATGGGTCTGACTCTGG - Intergenic
933942213 2:87254150-87254172 GGGAAAAATGCCTCTGAGTAGGG + Intergenic
936287431 2:111191488-111191510 GGAAGAAATCAGTATGTGTATGG + Intergenic
936338013 2:111607420-111607442 GGGAAAAATGCCTCTGAGTAGGG - Intergenic
937504022 2:122515960-122515982 ACAAAAAATCTGTCTGGGTATGG + Intergenic
1170222117 20:13952200-13952222 GGAAAAAATGTGTCTTGGTAGGG - Intronic
1177350209 21:19929233-19929255 GAAAAAAATTGGTCAGAATATGG + Intergenic
1180702228 22:17787798-17787820 GGTCAAAATCGGCCTGAGGATGG + Exonic
1184064589 22:42110366-42110388 GGAAAAATTTGGGCTGAGCAAGG - Intergenic
951456799 3:22901795-22901817 GGAAGAAATCAGTTTGAGTCTGG - Intergenic
951460816 3:22949716-22949738 GGAAAAAATAGCTCAGAGTCAGG - Intergenic
951460904 3:22950781-22950803 GGAAAAAATAGCTCAGAGTCAGG + Intergenic
955743990 3:62121700-62121722 GGAAAAAAATGGTCCCAGTAGGG - Intronic
959484490 3:106911023-106911045 GGTAATAATTGGTCTGGGTAAGG - Intergenic
963563396 3:146896571-146896593 AGTAAAAATCAGTCTGAATAAGG + Intergenic
966531885 3:180989965-180989987 GGAAAAAATCGGTCTGAGTAAGG - Intergenic
968108878 3:196025940-196025962 GAAAAAAATCTGTCTTAGAATGG + Intergenic
969178007 4:5414473-5414495 GGAAAAAATTGGACTTAGAATGG + Intronic
971700251 4:29963466-29963488 GGCAAAAAACTGCCTGAGTAGGG - Intergenic
972261824 4:37416274-37416296 GTGAGAAATCGGTCTGAGCATGG + Intronic
972585731 4:40435716-40435738 GGCAGAAATAGGCCTGAGTAAGG + Intronic
972946291 4:44260471-44260493 AGAAAAAATAAGTCAGAGTAAGG + Intronic
975963122 4:79937560-79937582 GGAACAAATCTGTTTGAGTATGG - Intronic
978380988 4:108128484-108128506 GGAAAAAAGCAGACTGAGGAAGG + Intronic
979900382 4:126208769-126208791 AGAAAAAATCTGGCTGAGGATGG + Intergenic
981434284 4:144701995-144702017 AGAAAAAATAGGGCTGAGTGTGG + Intronic
982409910 4:155062930-155062952 GGAAAATATAAGTCTGAGAAAGG + Intergenic
982734571 4:158992182-158992204 GGAAAACACTGGTCTGAGTCTGG - Intronic
982994301 4:162321345-162321367 GGAAAAAAATGGTTTGAGTTGGG - Intergenic
983000834 4:162411890-162411912 GGAAAAAATGAGTCTAAGAATGG + Intergenic
983064192 4:163190518-163190540 GGTAAAGATGGGACTGAGTAAGG + Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
987074682 5:14369747-14369769 GCTAAAAATCTGTATGAGTAAGG + Intronic
987364057 5:17132783-17132805 GGTAAAAATCAGTTTGAGTGAGG - Intronic
992516538 5:77499569-77499591 GGAAAAAACAGGTCTGGGTTTGG - Intronic
995046979 5:107661651-107661673 GGAAAAAATAATTCTAAGTATGG - Intronic
998464068 5:142329107-142329129 GGAAATAATCTGTTTGGGTAGGG - Intergenic
1005876443 6:30013570-30013592 GGAAAAAACAGGTTTGGGTAGGG + Intergenic
1006049738 6:31332672-31332694 GGAAAAATTTGGACTGAGTGGGG - Intronic
1016383787 6:143511904-143511926 GGAAAATATGAGTCTGAGTCAGG + Intergenic
1019176675 6:170162776-170162798 GGAAAAAATCCTTCAGAGGAAGG - Intergenic
1029030136 7:97458487-97458509 TAAAAAAATCGGGCTGGGTATGG + Intergenic
1033061399 7:138112225-138112247 GCAAAAAAGAAGTCTGAGTAAGG + Intronic
1037762950 8:21754108-21754130 GGGAAAAATAGGTCGGAGTAGGG - Intronic
1039384469 8:37121100-37121122 GGAGAATATTGGTCTGAGTCAGG - Intergenic
1041946583 8:63450431-63450453 GGAAAGAATAGGTCTGAACATGG - Intergenic
1046948120 8:119993858-119993880 GGAAAAAATCAGGCTGAGGCCGG + Intronic
1049415756 8:142494198-142494220 GTAAAAACTCAGTCTGAGTTTGG - Intronic
1050586664 9:7119717-7119739 TGAAAACATAGTTCTGAGTAGGG + Intergenic
1052813529 9:33082518-33082540 GTAGAAAAGCAGTCTGAGTAGGG - Intergenic
1060025323 9:120165913-120165935 GGTATAAATCGGTCTGGGTCTGG + Intergenic
1192244984 X:69364569-69364591 GGAAAAAAATGGTCTGAGTCTGG - Intergenic
1194283861 X:91985570-91985592 GGAAAAATAGGGTTTGAGTATGG - Intronic
1196061458 X:111412003-111412025 GGAAAAAATCGGATAGAATAAGG + Intronic
1196418042 X:115494228-115494250 GGATAAAATCGGTCTGAGATGGG - Intergenic
1196514040 X:116548549-116548571 GGAAAAAATCTGTAGAAGTATGG - Intergenic
1197005416 X:121490609-121490631 AGAAAATAAGGGTCTGAGTATGG - Intergenic
1200601430 Y:5210127-5210149 GGAAAAATAGGGTTTGAGTATGG - Intronic