ID: 966533303

View in Genome Browser
Species Human (GRCh38)
Location 3:181004380-181004402
Sequence TTGACTTTAGACTGCTATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966533299_966533303 0 Left 966533299 3:181004357-181004379 CCACCAAGCTTGAGTGTCCCAGT 0: 2
1: 40
2: 118
3: 218
4: 429
Right 966533303 3:181004380-181004402 TTGACTTTAGACTGCTATGCTGG No data
966533300_966533303 -3 Left 966533300 3:181004360-181004382 CCAAGCTTGAGTGTCCCAGTTTG No data
Right 966533303 3:181004380-181004402 TTGACTTTAGACTGCTATGCTGG No data
966533294_966533303 7 Left 966533294 3:181004350-181004372 CCTCCCCCCACCAAGCTTGAGTG 0: 20
1: 74
2: 177
3: 408
4: 740
Right 966533303 3:181004380-181004402 TTGACTTTAGACTGCTATGCTGG No data
966533293_966533303 8 Left 966533293 3:181004349-181004371 CCCTCCCCCCACCAAGCTTGAGT 0: 18
1: 105
2: 308
3: 504
4: 754
Right 966533303 3:181004380-181004402 TTGACTTTAGACTGCTATGCTGG No data
966533292_966533303 9 Left 966533292 3:181004348-181004370 CCCCTCCCCCCACCAAGCTTGAG 0: 51
1: 199
2: 400
3: 557
4: 839
Right 966533303 3:181004380-181004402 TTGACTTTAGACTGCTATGCTGG No data
966533296_966533303 3 Left 966533296 3:181004354-181004376 CCCCCACCAAGCTTGAGTGTCCC 0: 32
1: 87
2: 215
3: 374
4: 575
Right 966533303 3:181004380-181004402 TTGACTTTAGACTGCTATGCTGG No data
966533297_966533303 2 Left 966533297 3:181004355-181004377 CCCCACCAAGCTTGAGTGTCCCA 0: 34
1: 111
2: 228
3: 375
4: 606
Right 966533303 3:181004380-181004402 TTGACTTTAGACTGCTATGCTGG No data
966533291_966533303 27 Left 966533291 3:181004330-181004352 CCTCAGTAATGACAGACGCCCCT 0: 3
1: 88
2: 395
3: 911
4: 1427
Right 966533303 3:181004380-181004402 TTGACTTTAGACTGCTATGCTGG No data
966533295_966533303 4 Left 966533295 3:181004353-181004375 CCCCCCACCAAGCTTGAGTGTCC 0: 19
1: 83
2: 174
3: 341
4: 565
Right 966533303 3:181004380-181004402 TTGACTTTAGACTGCTATGCTGG No data
966533298_966533303 1 Left 966533298 3:181004356-181004378 CCCACCAAGCTTGAGTGTCCCAG 0: 33
1: 114
2: 234
3: 344
4: 500
Right 966533303 3:181004380-181004402 TTGACTTTAGACTGCTATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966533303 Original CRISPR TTGACTTTAGACTGCTATGC TGG Intergenic
No off target data available for this crispr