ID: 966537964

View in Genome Browser
Species Human (GRCh38)
Location 3:181055160-181055182
Sequence CTACCAATTGGTAATGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966537961_966537964 -1 Left 966537961 3:181055138-181055160 CCCAGCTGAGCTAGTGGCTTGTC No data
Right 966537964 3:181055160-181055182 CTACCAATTGGTAATGAGCCTGG No data
966537962_966537964 -2 Left 966537962 3:181055139-181055161 CCAGCTGAGCTAGTGGCTTGTCT No data
Right 966537964 3:181055160-181055182 CTACCAATTGGTAATGAGCCTGG No data
966537959_966537964 17 Left 966537959 3:181055120-181055142 CCTTCAGGATACAGTGCTCCCAG No data
Right 966537964 3:181055160-181055182 CTACCAATTGGTAATGAGCCTGG No data
966537958_966537964 18 Left 966537958 3:181055119-181055141 CCCTTCAGGATACAGTGCTCCCA No data
Right 966537964 3:181055160-181055182 CTACCAATTGGTAATGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966537964 Original CRISPR CTACCAATTGGTAATGAGCC TGG Intergenic
No off target data available for this crispr