ID: 966538271 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:181060022-181060044 |
| Sequence | GCGTTAGTGCCACCCGGCCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 966538266_966538271 | 21 | Left | 966538266 | 3:181059978-181060000 | CCATTTCTGCGGAAGTAAGGAGC | No data | ||
| Right | 966538271 | 3:181060022-181060044 | GCGTTAGTGCCACCCGGCCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 966538271 | Original CRISPR | GCGTTAGTGCCACCCGGCCT TGG | Intergenic | ||