ID: 966538271

View in Genome Browser
Species Human (GRCh38)
Location 3:181060022-181060044
Sequence GCGTTAGTGCCACCCGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966538266_966538271 21 Left 966538266 3:181059978-181060000 CCATTTCTGCGGAAGTAAGGAGC No data
Right 966538271 3:181060022-181060044 GCGTTAGTGCCACCCGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966538271 Original CRISPR GCGTTAGTGCCACCCGGCCT TGG Intergenic