ID: 966548439

View in Genome Browser
Species Human (GRCh38)
Location 3:181178322-181178344
Sequence CAGAGGCATCAATGTAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966548439_966548444 16 Left 966548439 3:181178322-181178344 CCAACTTTACATTGATGCCTCTG No data
Right 966548444 3:181178361-181178383 CTTTGCACTTTGCTTTCCTCAGG No data
966548439_966548441 -10 Left 966548439 3:181178322-181178344 CCAACTTTACATTGATGCCTCTG No data
Right 966548441 3:181178335-181178357 GATGCCTCTGGACTCATTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966548439 Original CRISPR CAGAGGCATCAATGTAAAGT TGG (reversed) Intergenic
No off target data available for this crispr