ID: 966549914 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:181193543-181193565 |
| Sequence | ATAAAAATACAGTTGAAGCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 966549912_966549914 | -1 | Left | 966549912 | 3:181193521-181193543 | CCCAAAGAAAAGCTGACTACTCA | No data | ||
| Right | 966549914 | 3:181193543-181193565 | ATAAAAATACAGTTGAAGCTTGG | No data | ||||
| 966549913_966549914 | -2 | Left | 966549913 | 3:181193522-181193544 | CCAAAGAAAAGCTGACTACTCAT | No data | ||
| Right | 966549914 | 3:181193543-181193565 | ATAAAAATACAGTTGAAGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 966549914 | Original CRISPR | ATAAAAATACAGTTGAAGCT TGG | Intergenic | ||
| No off target data available for this crispr | |||||