ID: 966549914

View in Genome Browser
Species Human (GRCh38)
Location 3:181193543-181193565
Sequence ATAAAAATACAGTTGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966549912_966549914 -1 Left 966549912 3:181193521-181193543 CCCAAAGAAAAGCTGACTACTCA No data
Right 966549914 3:181193543-181193565 ATAAAAATACAGTTGAAGCTTGG No data
966549913_966549914 -2 Left 966549913 3:181193522-181193544 CCAAAGAAAAGCTGACTACTCAT No data
Right 966549914 3:181193543-181193565 ATAAAAATACAGTTGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966549914 Original CRISPR ATAAAAATACAGTTGAAGCT TGG Intergenic
No off target data available for this crispr