ID: 966550553

View in Genome Browser
Species Human (GRCh38)
Location 3:181199841-181199863
Sequence AGGTGCACAGAGTATAAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966550553_966550557 1 Left 966550553 3:181199841-181199863 CCACTCTTATACTCTGTGCACCT No data
Right 966550557 3:181199865-181199887 CCTATAGGCATAACACCTTGTGG No data
966550553_966550559 23 Left 966550553 3:181199841-181199863 CCACTCTTATACTCTGTGCACCT No data
Right 966550559 3:181199887-181199909 GAAGCTGCCAAGACTTATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966550553 Original CRISPR AGGTGCACAGAGTATAAGAG TGG (reversed) Intergenic
No off target data available for this crispr