ID: 966553352

View in Genome Browser
Species Human (GRCh38)
Location 3:181230216-181230238
Sequence CCTGACACCTCAACCAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966553352_966553356 -3 Left 966553352 3:181230216-181230238 CCTACTCTGGTTGAGGTGTCAGG No data
Right 966553356 3:181230236-181230258 AGGGGAGTGATGAGATTCCTTGG No data
966553352_966553359 20 Left 966553352 3:181230216-181230238 CCTACTCTGGTTGAGGTGTCAGG No data
Right 966553359 3:181230259-181230281 GTATAGATAGTTTAGTGTGCTGG No data
966553352_966553357 -2 Left 966553352 3:181230216-181230238 CCTACTCTGGTTGAGGTGTCAGG No data
Right 966553357 3:181230237-181230259 GGGGAGTGATGAGATTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966553352 Original CRISPR CCTGACACCTCAACCAGAGT AGG (reversed) Intergenic
No off target data available for this crispr