ID: 966557441

View in Genome Browser
Species Human (GRCh38)
Location 3:181278883-181278905
Sequence GGGGCTTTAAATACACTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966557441_966557451 19 Left 966557441 3:181278883-181278905 CCCCCTAGTGTATTTAAAGCCCC No data
Right 966557451 3:181278925-181278947 TTAATAAGCTAATAACAAACAGG No data
966557441_966557446 -7 Left 966557441 3:181278883-181278905 CCCCCTAGTGTATTTAAAGCCCC No data
Right 966557446 3:181278899-181278921 AAGCCCCCAAAGGTGTGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966557441 Original CRISPR GGGGCTTTAAATACACTAGG GGG (reversed) Intergenic