ID: 966558481

View in Genome Browser
Species Human (GRCh38)
Location 3:181291362-181291384
Sequence AATTCTTCTTGGAGTAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966558478_966558481 -6 Left 966558478 3:181291345-181291367 CCTGGCTTTCTAATTGAAATTCT No data
Right 966558481 3:181291362-181291384 AATTCTTCTTGGAGTAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966558481 Original CRISPR AATTCTTCTTGGAGTAGAGT GGG Intergenic
No off target data available for this crispr