ID: 966558999

View in Genome Browser
Species Human (GRCh38)
Location 3:181297839-181297861
Sequence CAGGCAAGATTTTATAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966558999_966559001 -6 Left 966558999 3:181297839-181297861 CCTCCTCTATAAAATCTTGCCTG No data
Right 966559001 3:181297856-181297878 TGCCTGCCCTCCCTCCACACAGG No data
966558999_966559008 27 Left 966558999 3:181297839-181297861 CCTCCTCTATAAAATCTTGCCTG No data
Right 966559008 3:181297889-181297911 CTTCCCTCCCTGTACATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966558999 Original CRISPR CAGGCAAGATTTTATAGAGG AGG (reversed) Intergenic
No off target data available for this crispr