ID: 966559000

View in Genome Browser
Species Human (GRCh38)
Location 3:181297842-181297864
Sequence GGGCAGGCAAGATTTTATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966559000_966559008 24 Left 966559000 3:181297842-181297864 CCTCTATAAAATCTTGCCTGCCC No data
Right 966559008 3:181297889-181297911 CTTCCCTCCCTGTACATATCTGG No data
966559000_966559001 -9 Left 966559000 3:181297842-181297864 CCTCTATAAAATCTTGCCTGCCC No data
Right 966559001 3:181297856-181297878 TGCCTGCCCTCCCTCCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966559000 Original CRISPR GGGCAGGCAAGATTTTATAG AGG (reversed) Intergenic
No off target data available for this crispr