ID: 966559001

View in Genome Browser
Species Human (GRCh38)
Location 3:181297856-181297878
Sequence TGCCTGCCCTCCCTCCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966558999_966559001 -6 Left 966558999 3:181297839-181297861 CCTCCTCTATAAAATCTTGCCTG No data
Right 966559001 3:181297856-181297878 TGCCTGCCCTCCCTCCACACAGG No data
966559000_966559001 -9 Left 966559000 3:181297842-181297864 CCTCTATAAAATCTTGCCTGCCC No data
Right 966559001 3:181297856-181297878 TGCCTGCCCTCCCTCCACACAGG No data
966558998_966559001 9 Left 966558998 3:181297824-181297846 CCTGCTCAAATATTACCTCCTCT No data
Right 966559001 3:181297856-181297878 TGCCTGCCCTCCCTCCACACAGG No data
966558997_966559001 19 Left 966558997 3:181297814-181297836 CCTTTGAGATCCTGCTCAAATAT No data
Right 966559001 3:181297856-181297878 TGCCTGCCCTCCCTCCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966559001 Original CRISPR TGCCTGCCCTCCCTCCACAC AGG Intergenic
No off target data available for this crispr