ID: 966559006

View in Genome Browser
Species Human (GRCh38)
Location 3:181297867-181297889
Sequence GAAAAATTCTGCCTGTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966559006_966559013 7 Left 966559006 3:181297867-181297889 CCTCCACACAGGCAGAATTTTTC No data
Right 966559013 3:181297897-181297919 CCTGTACATATCTGGATTAAAGG No data
966559006_966559008 -1 Left 966559006 3:181297867-181297889 CCTCCACACAGGCAGAATTTTTC No data
Right 966559008 3:181297889-181297911 CTTCCCTCCCTGTACATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966559006 Original CRISPR GAAAAATTCTGCCTGTGTGG AGG (reversed) Intergenic
No off target data available for this crispr