ID: 966559007

View in Genome Browser
Species Human (GRCh38)
Location 3:181297870-181297892
Sequence GAAGAAAAATTCTGCCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966559007_966559013 4 Left 966559007 3:181297870-181297892 CCACACAGGCAGAATTTTTCTTC No data
Right 966559013 3:181297897-181297919 CCTGTACATATCTGGATTAAAGG No data
966559007_966559008 -4 Left 966559007 3:181297870-181297892 CCACACAGGCAGAATTTTTCTTC No data
Right 966559008 3:181297889-181297911 CTTCCCTCCCTGTACATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966559007 Original CRISPR GAAGAAAAATTCTGCCTGTG TGG (reversed) Intergenic
No off target data available for this crispr