ID: 966559008

View in Genome Browser
Species Human (GRCh38)
Location 3:181297889-181297911
Sequence CTTCCCTCCCTGTACATATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966559003_966559008 4 Left 966559003 3:181297862-181297884 CCCTCCCTCCACACAGGCAGAAT No data
Right 966559008 3:181297889-181297911 CTTCCCTCCCTGTACATATCTGG No data
966559002_966559008 8 Left 966559002 3:181297858-181297880 CCTGCCCTCCCTCCACACAGGCA No data
Right 966559008 3:181297889-181297911 CTTCCCTCCCTGTACATATCTGG No data
966559000_966559008 24 Left 966559000 3:181297842-181297864 CCTCTATAAAATCTTGCCTGCCC No data
Right 966559008 3:181297889-181297911 CTTCCCTCCCTGTACATATCTGG No data
966559007_966559008 -4 Left 966559007 3:181297870-181297892 CCACACAGGCAGAATTTTTCTTC No data
Right 966559008 3:181297889-181297911 CTTCCCTCCCTGTACATATCTGG No data
966559006_966559008 -1 Left 966559006 3:181297867-181297889 CCTCCACACAGGCAGAATTTTTC No data
Right 966559008 3:181297889-181297911 CTTCCCTCCCTGTACATATCTGG No data
966558999_966559008 27 Left 966558999 3:181297839-181297861 CCTCCTCTATAAAATCTTGCCTG No data
Right 966559008 3:181297889-181297911 CTTCCCTCCCTGTACATATCTGG No data
966559004_966559008 3 Left 966559004 3:181297863-181297885 CCTCCCTCCACACAGGCAGAATT No data
Right 966559008 3:181297889-181297911 CTTCCCTCCCTGTACATATCTGG No data
966559005_966559008 0 Left 966559005 3:181297866-181297888 CCCTCCACACAGGCAGAATTTTT No data
Right 966559008 3:181297889-181297911 CTTCCCTCCCTGTACATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966559008 Original CRISPR CTTCCCTCCCTGTACATATC TGG Intergenic
No off target data available for this crispr