ID: 966559568

View in Genome Browser
Species Human (GRCh38)
Location 3:181304908-181304930
Sequence CACTATGAGCATCTTTTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966559568_966559569 24 Left 966559568 3:181304908-181304930 CCTTGTAAAAGATGCTCATAGTG No data
Right 966559569 3:181304955-181304977 TATTAAAATAATTAAATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966559568 Original CRISPR CACTATGAGCATCTTTTACA AGG (reversed) Intergenic
No off target data available for this crispr