ID: 966560604

View in Genome Browser
Species Human (GRCh38)
Location 3:181315636-181315658
Sequence TAGACATTTAATAAAAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966560602_966560604 6 Left 966560602 3:181315607-181315629 CCGTGTATTAAAACAAGGCAAAA No data
Right 966560604 3:181315636-181315658 TAGACATTTAATAAAAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966560604 Original CRISPR TAGACATTTAATAAAAATTC TGG Intergenic
No off target data available for this crispr