ID: 966563941

View in Genome Browser
Species Human (GRCh38)
Location 3:181355214-181355236
Sequence GGAGACTAGGAAATAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966563941_966563947 19 Left 966563941 3:181355214-181355236 CCTGTGTTTATTTCCTAGTCTCC No data
Right 966563947 3:181355256-181355278 CAGAAGCCCCAATTTCCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966563941 Original CRISPR GGAGACTAGGAAATAAACAC AGG (reversed) Intergenic
No off target data available for this crispr