ID: 966563947

View in Genome Browser
Species Human (GRCh38)
Location 3:181355256-181355278
Sequence CAGAAGCCCCAATTTCCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966563940_966563947 23 Left 966563940 3:181355210-181355232 CCTTCCTGTGTTTATTTCCTAGT No data
Right 966563947 3:181355256-181355278 CAGAAGCCCCAATTTCCTATTGG No data
966563942_966563947 6 Left 966563942 3:181355227-181355249 CCTAGTCTCCCTTGAACTTCATC No data
Right 966563947 3:181355256-181355278 CAGAAGCCCCAATTTCCTATTGG No data
966563943_966563947 -2 Left 966563943 3:181355235-181355257 CCCTTGAACTTCATCATTTCCCA No data
Right 966563947 3:181355256-181355278 CAGAAGCCCCAATTTCCTATTGG No data
966563944_966563947 -3 Left 966563944 3:181355236-181355258 CCTTGAACTTCATCATTTCCCAG No data
Right 966563947 3:181355256-181355278 CAGAAGCCCCAATTTCCTATTGG No data
966563941_966563947 19 Left 966563941 3:181355214-181355236 CCTGTGTTTATTTCCTAGTCTCC No data
Right 966563947 3:181355256-181355278 CAGAAGCCCCAATTTCCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966563947 Original CRISPR CAGAAGCCCCAATTTCCTAT TGG Intergenic
No off target data available for this crispr