ID: 966564428

View in Genome Browser
Species Human (GRCh38)
Location 3:181360708-181360730
Sequence TTGCCCAGGCTGGAGTGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 548749
Summary {0: 445, 1: 38586, 2: 111656, 3: 182952, 4: 215110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966564428_966564432 25 Left 966564428 3:181360708-181360730 CCATGGCACTCCAGCCTGGGCAA 0: 445
1: 38586
2: 111656
3: 182952
4: 215110
Right 966564432 3:181360756-181360778 AAAGAAGAAGAAGAAGAAGAAGG 0: 66
1: 601
2: 1484
3: 3755
4: 10919
966564428_966564433 29 Left 966564428 3:181360708-181360730 CCATGGCACTCCAGCCTGGGCAA 0: 445
1: 38586
2: 111656
3: 182952
4: 215110
Right 966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG 0: 10
1: 198
2: 474
3: 1669
4: 7148
966564428_966564434 30 Left 966564428 3:181360708-181360730 CCATGGCACTCCAGCCTGGGCAA 0: 445
1: 38586
2: 111656
3: 182952
4: 215110
Right 966564434 3:181360761-181360783 AGAAGAAGAAGAAGAAGGAAGGG 0: 10
1: 74
2: 652
3: 2080
4: 7661

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966564428 Original CRISPR TTGCCCAGGCTGGAGTGCCA TGG (reversed) Intergenic
Too many off-targets to display for this crispr