ID: 966564429

View in Genome Browser
Species Human (GRCh38)
Location 3:181360718-181360740
Sequence TTCACTCTTGTTGCCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107344
Summary {0: 11753, 1: 22317, 2: 29357, 3: 23571, 4: 20346}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966564429_966564433 19 Left 966564429 3:181360718-181360740 CCAGCCTGGGCAACAAGAGTGAA 0: 11753
1: 22317
2: 29357
3: 23571
4: 20346
Right 966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG 0: 10
1: 198
2: 474
3: 1669
4: 7148
966564429_966564432 15 Left 966564429 3:181360718-181360740 CCAGCCTGGGCAACAAGAGTGAA 0: 11753
1: 22317
2: 29357
3: 23571
4: 20346
Right 966564432 3:181360756-181360778 AAAGAAGAAGAAGAAGAAGAAGG 0: 66
1: 601
2: 1484
3: 3755
4: 10919
966564429_966564434 20 Left 966564429 3:181360718-181360740 CCAGCCTGGGCAACAAGAGTGAA 0: 11753
1: 22317
2: 29357
3: 23571
4: 20346
Right 966564434 3:181360761-181360783 AGAAGAAGAAGAAGAAGGAAGGG 0: 10
1: 74
2: 652
3: 2080
4: 7661

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966564429 Original CRISPR TTCACTCTTGTTGCCCAGGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr