ID: 966564429 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:181360718-181360740 |
Sequence | TTCACTCTTGTTGCCCAGGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 107344 | |||
Summary | {0: 11753, 1: 22317, 2: 29357, 3: 23571, 4: 20346} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
966564429_966564433 | 19 | Left | 966564429 | 3:181360718-181360740 | CCAGCCTGGGCAACAAGAGTGAA | 0: 11753 1: 22317 2: 29357 3: 23571 4: 20346 |
||
Right | 966564433 | 3:181360760-181360782 | AAGAAGAAGAAGAAGAAGGAAGG | 0: 10 1: 198 2: 474 3: 1669 4: 7148 |
||||
966564429_966564432 | 15 | Left | 966564429 | 3:181360718-181360740 | CCAGCCTGGGCAACAAGAGTGAA | 0: 11753 1: 22317 2: 29357 3: 23571 4: 20346 |
||
Right | 966564432 | 3:181360756-181360778 | AAAGAAGAAGAAGAAGAAGAAGG | 0: 66 1: 601 2: 1484 3: 3755 4: 10919 |
||||
966564429_966564434 | 20 | Left | 966564429 | 3:181360718-181360740 | CCAGCCTGGGCAACAAGAGTGAA | 0: 11753 1: 22317 2: 29357 3: 23571 4: 20346 |
||
Right | 966564434 | 3:181360761-181360783 | AGAAGAAGAAGAAGAAGGAAGGG | 0: 10 1: 74 2: 652 3: 2080 4: 7661 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
966564429 | Original CRISPR | TTCACTCTTGTTGCCCAGGC TGG (reversed) | Intergenic | ||
Too many off-targets to display for this crispr |