ID: 966564431

View in Genome Browser
Species Human (GRCh38)
Location 3:181360744-181360766
Sequence TCTTCTTCTTTTTTTTGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194309
Summary {0: 33, 1: 450, 2: 7835, 3: 100787, 4: 85204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966564431_966564436 20 Left 966564431 3:181360744-181360766 CCGTCTCAAAAAAAAGAAGAAGA 0: 33
1: 450
2: 7835
3: 100787
4: 85204
Right 966564436 3:181360787-181360809 TTTCAACCATACTAAAAGCTGGG No data
966564431_966564433 -7 Left 966564431 3:181360744-181360766 CCGTCTCAAAAAAAAGAAGAAGA 0: 33
1: 450
2: 7835
3: 100787
4: 85204
Right 966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG 0: 10
1: 198
2: 474
3: 1669
4: 7148
966564431_966564434 -6 Left 966564431 3:181360744-181360766 CCGTCTCAAAAAAAAGAAGAAGA 0: 33
1: 450
2: 7835
3: 100787
4: 85204
Right 966564434 3:181360761-181360783 AGAAGAAGAAGAAGAAGGAAGGG 0: 10
1: 74
2: 652
3: 2080
4: 7661
966564431_966564435 19 Left 966564431 3:181360744-181360766 CCGTCTCAAAAAAAAGAAGAAGA 0: 33
1: 450
2: 7835
3: 100787
4: 85204
Right 966564435 3:181360786-181360808 TTTTCAACCATACTAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966564431 Original CRISPR TCTTCTTCTTTTTTTTGAGA CGG (reversed) Intergenic
Too many off-targets to display for this crispr