ID: 966564433

View in Genome Browser
Species Human (GRCh38)
Location 3:181360760-181360782
Sequence AAGAAGAAGAAGAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9499
Summary {0: 10, 1: 198, 2: 474, 3: 1669, 4: 7148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966564431_966564433 -7 Left 966564431 3:181360744-181360766 CCGTCTCAAAAAAAAGAAGAAGA 0: 33
1: 450
2: 7835
3: 100787
4: 85204
Right 966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG 0: 10
1: 198
2: 474
3: 1669
4: 7148
966564430_966564433 15 Left 966564430 3:181360722-181360744 CCTGGGCAACAAGAGTGAAATTC 0: 615
1: 12761
2: 23075
3: 28876
4: 22770
Right 966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG 0: 10
1: 198
2: 474
3: 1669
4: 7148
966564428_966564433 29 Left 966564428 3:181360708-181360730 CCATGGCACTCCAGCCTGGGCAA 0: 445
1: 38586
2: 111656
3: 182952
4: 215110
Right 966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG 0: 10
1: 198
2: 474
3: 1669
4: 7148
966564429_966564433 19 Left 966564429 3:181360718-181360740 CCAGCCTGGGCAACAAGAGTGAA 0: 11753
1: 22317
2: 29357
3: 23571
4: 20346
Right 966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG 0: 10
1: 198
2: 474
3: 1669
4: 7148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966564433 Original CRISPR AAGAAGAAGAAGAAGAAGGA AGG Intergenic
Too many off-targets to display for this crispr