ID: 966567259

View in Genome Browser
Species Human (GRCh38)
Location 3:181396902-181396924
Sequence ATGGAAAAAAGTGCCATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966567259_966567267 10 Left 966567259 3:181396902-181396924 CCCACAATGGCACTTTTTTCCAT No data
Right 966567267 3:181396935-181396957 CAGGTCACTGTTTGTGTGGGAGG No data
966567259_966567269 22 Left 966567259 3:181396902-181396924 CCCACAATGGCACTTTTTTCCAT No data
Right 966567269 3:181396947-181396969 TGTGTGGGAGGATATGAGCTGGG No data
966567259_966567265 7 Left 966567259 3:181396902-181396924 CCCACAATGGCACTTTTTTCCAT No data
Right 966567265 3:181396932-181396954 TGCCAGGTCACTGTTTGTGTGGG No data
966567259_966567270 23 Left 966567259 3:181396902-181396924 CCCACAATGGCACTTTTTTCCAT No data
Right 966567270 3:181396948-181396970 GTGTGGGAGGATATGAGCTGGGG No data
966567259_966567262 -9 Left 966567259 3:181396902-181396924 CCCACAATGGCACTTTTTTCCAT No data
Right 966567262 3:181396916-181396938 TTTTTCCATGGATGACTGCCAGG No data
966567259_966567264 6 Left 966567259 3:181396902-181396924 CCCACAATGGCACTTTTTTCCAT No data
Right 966567264 3:181396931-181396953 CTGCCAGGTCACTGTTTGTGTGG No data
966567259_966567268 21 Left 966567259 3:181396902-181396924 CCCACAATGGCACTTTTTTCCAT No data
Right 966567268 3:181396946-181396968 TTGTGTGGGAGGATATGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966567259 Original CRISPR ATGGAAAAAAGTGCCATTGT GGG (reversed) Intergenic
No off target data available for this crispr