ID: 966567267

View in Genome Browser
Species Human (GRCh38)
Location 3:181396935-181396957
Sequence CAGGTCACTGTTTGTGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966567263_966567267 -9 Left 966567263 3:181396921-181396943 CCATGGATGACTGCCAGGTCACT No data
Right 966567267 3:181396935-181396957 CAGGTCACTGTTTGTGTGGGAGG No data
966567257_966567267 19 Left 966567257 3:181396893-181396915 CCCAAGTCTCCCACAATGGCACT No data
Right 966567267 3:181396935-181396957 CAGGTCACTGTTTGTGTGGGAGG No data
966567260_966567267 9 Left 966567260 3:181396903-181396925 CCACAATGGCACTTTTTTCCATG No data
Right 966567267 3:181396935-181396957 CAGGTCACTGTTTGTGTGGGAGG No data
966567259_966567267 10 Left 966567259 3:181396902-181396924 CCCACAATGGCACTTTTTTCCAT No data
Right 966567267 3:181396935-181396957 CAGGTCACTGTTTGTGTGGGAGG No data
966567258_966567267 18 Left 966567258 3:181396894-181396916 CCAAGTCTCCCACAATGGCACTT No data
Right 966567267 3:181396935-181396957 CAGGTCACTGTTTGTGTGGGAGG No data
966567255_966567267 26 Left 966567255 3:181396886-181396908 CCTGGGTCCCAAGTCTCCCACAA No data
Right 966567267 3:181396935-181396957 CAGGTCACTGTTTGTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966567267 Original CRISPR CAGGTCACTGTTTGTGTGGG AGG Intergenic
No off target data available for this crispr