ID: 966567268

View in Genome Browser
Species Human (GRCh38)
Location 3:181396946-181396968
Sequence TTGTGTGGGAGGATATGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966567263_966567268 2 Left 966567263 3:181396921-181396943 CCATGGATGACTGCCAGGTCACT No data
Right 966567268 3:181396946-181396968 TTGTGTGGGAGGATATGAGCTGG No data
966567258_966567268 29 Left 966567258 3:181396894-181396916 CCAAGTCTCCCACAATGGCACTT No data
Right 966567268 3:181396946-181396968 TTGTGTGGGAGGATATGAGCTGG No data
966567260_966567268 20 Left 966567260 3:181396903-181396925 CCACAATGGCACTTTTTTCCATG No data
Right 966567268 3:181396946-181396968 TTGTGTGGGAGGATATGAGCTGG No data
966567257_966567268 30 Left 966567257 3:181396893-181396915 CCCAAGTCTCCCACAATGGCACT No data
Right 966567268 3:181396946-181396968 TTGTGTGGGAGGATATGAGCTGG No data
966567259_966567268 21 Left 966567259 3:181396902-181396924 CCCACAATGGCACTTTTTTCCAT No data
Right 966567268 3:181396946-181396968 TTGTGTGGGAGGATATGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966567268 Original CRISPR TTGTGTGGGAGGATATGAGC TGG Intergenic
No off target data available for this crispr