ID: 966567270

View in Genome Browser
Species Human (GRCh38)
Location 3:181396948-181396970
Sequence GTGTGGGAGGATATGAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966567266_966567270 -9 Left 966567266 3:181396934-181396956 CCAGGTCACTGTTTGTGTGGGAG No data
Right 966567270 3:181396948-181396970 GTGTGGGAGGATATGAGCTGGGG No data
966567260_966567270 22 Left 966567260 3:181396903-181396925 CCACAATGGCACTTTTTTCCATG No data
Right 966567270 3:181396948-181396970 GTGTGGGAGGATATGAGCTGGGG No data
966567259_966567270 23 Left 966567259 3:181396902-181396924 CCCACAATGGCACTTTTTTCCAT No data
Right 966567270 3:181396948-181396970 GTGTGGGAGGATATGAGCTGGGG No data
966567263_966567270 4 Left 966567263 3:181396921-181396943 CCATGGATGACTGCCAGGTCACT No data
Right 966567270 3:181396948-181396970 GTGTGGGAGGATATGAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966567270 Original CRISPR GTGTGGGAGGATATGAGCTG GGG Intergenic
No off target data available for this crispr