ID: 966571620

View in Genome Browser
Species Human (GRCh38)
Location 3:181450402-181450424
Sequence GCACATAGTAAGCACTGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966571620_966571624 25 Left 966571620 3:181450402-181450424 CCCATTCAGTGCTTACTATGTGC No data
Right 966571624 3:181450450-181450472 CACAGTGACCACCATGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966571620 Original CRISPR GCACATAGTAAGCACTGAAT GGG (reversed) Intergenic
No off target data available for this crispr