ID: 966571621

View in Genome Browser
Species Human (GRCh38)
Location 3:181450403-181450425
Sequence GGCACATAGTAAGCACTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966571621_966571624 24 Left 966571621 3:181450403-181450425 CCATTCAGTGCTTACTATGTGCC No data
Right 966571624 3:181450450-181450472 CACAGTGACCACCATGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966571621 Original CRISPR GGCACATAGTAAGCACTGAA TGG (reversed) Intergenic
No off target data available for this crispr