ID: 966571624

View in Genome Browser
Species Human (GRCh38)
Location 3:181450450-181450472
Sequence CACAGTGACCACCATGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966571621_966571624 24 Left 966571621 3:181450403-181450425 CCATTCAGTGCTTACTATGTGCC No data
Right 966571624 3:181450450-181450472 CACAGTGACCACCATGATGTAGG No data
966571622_966571624 3 Left 966571622 3:181450424-181450446 CCCTAAGTGTTAACTTGTCATAT No data
Right 966571624 3:181450450-181450472 CACAGTGACCACCATGATGTAGG No data
966571620_966571624 25 Left 966571620 3:181450402-181450424 CCCATTCAGTGCTTACTATGTGC No data
Right 966571624 3:181450450-181450472 CACAGTGACCACCATGATGTAGG No data
966571623_966571624 2 Left 966571623 3:181450425-181450447 CCTAAGTGTTAACTTGTCATATA No data
Right 966571624 3:181450450-181450472 CACAGTGACCACCATGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966571624 Original CRISPR CACAGTGACCACCATGATGT AGG Intergenic
No off target data available for this crispr