ID: 966592113

View in Genome Browser
Species Human (GRCh38)
Location 3:181695351-181695373
Sequence CGTGGGCTGCTCCGAGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966592113_966592126 5 Left 966592113 3:181695351-181695373 CCTGCGCCTCGGAGCAGCCCACG No data
Right 966592126 3:181695379-181695401 GTGAAGGCGCGTGGGGAAGGGGG No data
966592113_966592118 -4 Left 966592113 3:181695351-181695373 CCTGCGCCTCGGAGCAGCCCACG No data
Right 966592118 3:181695370-181695392 CACGAGCCCGTGAAGGCGCGTGG No data
966592113_966592120 -2 Left 966592113 3:181695351-181695373 CCTGCGCCTCGGAGCAGCCCACG No data
Right 966592120 3:181695372-181695394 CGAGCCCGTGAAGGCGCGTGGGG No data
966592113_966592124 3 Left 966592113 3:181695351-181695373 CCTGCGCCTCGGAGCAGCCCACG No data
Right 966592124 3:181695377-181695399 CCGTGAAGGCGCGTGGGGAAGGG No data
966592113_966592119 -3 Left 966592113 3:181695351-181695373 CCTGCGCCTCGGAGCAGCCCACG No data
Right 966592119 3:181695371-181695393 ACGAGCCCGTGAAGGCGCGTGGG No data
966592113_966592125 4 Left 966592113 3:181695351-181695373 CCTGCGCCTCGGAGCAGCCCACG No data
Right 966592125 3:181695378-181695400 CGTGAAGGCGCGTGGGGAAGGGG No data
966592113_966592128 11 Left 966592113 3:181695351-181695373 CCTGCGCCTCGGAGCAGCCCACG No data
Right 966592128 3:181695385-181695407 GCGCGTGGGGAAGGGGGGCCTGG No data
966592113_966592122 2 Left 966592113 3:181695351-181695373 CCTGCGCCTCGGAGCAGCCCACG No data
Right 966592122 3:181695376-181695398 CCCGTGAAGGCGCGTGGGGAAGG No data
966592113_966592129 20 Left 966592113 3:181695351-181695373 CCTGCGCCTCGGAGCAGCCCACG No data
Right 966592129 3:181695394-181695416 GAAGGGGGGCCTGGAAAGCCCGG No data
966592113_966592130 21 Left 966592113 3:181695351-181695373 CCTGCGCCTCGGAGCAGCCCACG No data
Right 966592130 3:181695395-181695417 AAGGGGGGCCTGGAAAGCCCGGG No data
966592113_966592127 6 Left 966592113 3:181695351-181695373 CCTGCGCCTCGGAGCAGCCCACG No data
Right 966592127 3:181695380-181695402 TGAAGGCGCGTGGGGAAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966592113 Original CRISPR CGTGGGCTGCTCCGAGGCGC AGG (reversed) Intergenic
No off target data available for this crispr