ID: 966592272

View in Genome Browser
Species Human (GRCh38)
Location 3:181696064-181696086
Sequence GCGCAGCGGCGCCAGGTCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966592272_966592285 20 Left 966592272 3:181696064-181696086 CCTCGGACCTGGCGCCGCTGCGC No data
Right 966592285 3:181696107-181696129 CACAGTCGGGCGGCCAGTGGAGG No data
966592272_966592282 17 Left 966592272 3:181696064-181696086 CCTCGGACCTGGCGCCGCTGCGC No data
Right 966592282 3:181696104-181696126 CCCCACAGTCGGGCGGCCAGTGG No data
966592272_966592287 26 Left 966592272 3:181696064-181696086 CCTCGGACCTGGCGCCGCTGCGC No data
Right 966592287 3:181696113-181696135 CGGGCGGCCAGTGGAGGGCGAGG No data
966592272_966592286 21 Left 966592272 3:181696064-181696086 CCTCGGACCTGGCGCCGCTGCGC No data
Right 966592286 3:181696108-181696130 ACAGTCGGGCGGCCAGTGGAGGG No data
966592272_966592280 10 Left 966592272 3:181696064-181696086 CCTCGGACCTGGCGCCGCTGCGC No data
Right 966592280 3:181696097-181696119 CTCGCTTCCCCACAGTCGGGCGG No data
966592272_966592277 6 Left 966592272 3:181696064-181696086 CCTCGGACCTGGCGCCGCTGCGC No data
Right 966592277 3:181696093-181696115 GAGCCTCGCTTCCCCACAGTCGG No data
966592272_966592278 7 Left 966592272 3:181696064-181696086 CCTCGGACCTGGCGCCGCTGCGC No data
Right 966592278 3:181696094-181696116 AGCCTCGCTTCCCCACAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966592272 Original CRISPR GCGCAGCGGCGCCAGGTCCG AGG (reversed) Intergenic
No off target data available for this crispr