ID: 966592825

View in Genome Browser
Species Human (GRCh38)
Location 3:181700538-181700560
Sequence GCTCTGTAATTCCTTCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966592825_966592828 -6 Left 966592825 3:181700538-181700560 CCTGAGAGAAGGAATTACAGAGC No data
Right 966592828 3:181700555-181700577 CAGAGCATGGCGAAGCTGGAAGG No data
966592825_966592832 2 Left 966592825 3:181700538-181700560 CCTGAGAGAAGGAATTACAGAGC No data
Right 966592832 3:181700563-181700585 GGCGAAGCTGGAAGGTGGGAGGG No data
966592825_966592836 26 Left 966592825 3:181700538-181700560 CCTGAGAGAAGGAATTACAGAGC No data
Right 966592836 3:181700587-181700609 TTCTGCGGGAAGTCGAGCGAGGG No data
966592825_966592831 1 Left 966592825 3:181700538-181700560 CCTGAGAGAAGGAATTACAGAGC No data
Right 966592831 3:181700562-181700584 TGGCGAAGCTGGAAGGTGGGAGG No data
966592825_966592833 11 Left 966592825 3:181700538-181700560 CCTGAGAGAAGGAATTACAGAGC No data
Right 966592833 3:181700572-181700594 GGAAGGTGGGAGGGTTTCTGCGG No data
966592825_966592837 27 Left 966592825 3:181700538-181700560 CCTGAGAGAAGGAATTACAGAGC No data
Right 966592837 3:181700588-181700610 TCTGCGGGAAGTCGAGCGAGGGG No data
966592825_966592827 -10 Left 966592825 3:181700538-181700560 CCTGAGAGAAGGAATTACAGAGC No data
Right 966592827 3:181700551-181700573 ATTACAGAGCATGGCGAAGCTGG No data
966592825_966592834 12 Left 966592825 3:181700538-181700560 CCTGAGAGAAGGAATTACAGAGC No data
Right 966592834 3:181700573-181700595 GAAGGTGGGAGGGTTTCTGCGGG No data
966592825_966592835 25 Left 966592825 3:181700538-181700560 CCTGAGAGAAGGAATTACAGAGC No data
Right 966592835 3:181700586-181700608 TTTCTGCGGGAAGTCGAGCGAGG No data
966592825_966592829 -3 Left 966592825 3:181700538-181700560 CCTGAGAGAAGGAATTACAGAGC No data
Right 966592829 3:181700558-181700580 AGCATGGCGAAGCTGGAAGGTGG No data
966592825_966592830 -2 Left 966592825 3:181700538-181700560 CCTGAGAGAAGGAATTACAGAGC No data
Right 966592830 3:181700559-181700581 GCATGGCGAAGCTGGAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966592825 Original CRISPR GCTCTGTAATTCCTTCTCTC AGG (reversed) Intergenic
No off target data available for this crispr