ID: 966592828

View in Genome Browser
Species Human (GRCh38)
Location 3:181700555-181700577
Sequence CAGAGCATGGCGAAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966592825_966592828 -6 Left 966592825 3:181700538-181700560 CCTGAGAGAAGGAATTACAGAGC No data
Right 966592828 3:181700555-181700577 CAGAGCATGGCGAAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966592828 Original CRISPR CAGAGCATGGCGAAGCTGGA AGG Intergenic
No off target data available for this crispr