ID: 966594346

View in Genome Browser
Species Human (GRCh38)
Location 3:181712426-181712448
Sequence CGGCAACTCCACCGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966594332_966594346 12 Left 966594332 3:181712391-181712413 CCGCCGGGCCCGCAGCAAACTTC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 966594346 3:181712426-181712448 CGGCAACTCCACCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 16
4: 55
966594339_966594346 4 Left 966594339 3:181712399-181712421 CCCGCAGCAAACTTCGGGGGGCG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 966594346 3:181712426-181712448 CGGCAACTCCACCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 16
4: 55
966594340_966594346 3 Left 966594340 3:181712400-181712422 CCGCAGCAAACTTCGGGGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 45
Right 966594346 3:181712426-181712448 CGGCAACTCCACCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 16
4: 55
966594334_966594346 9 Left 966594334 3:181712394-181712416 CCGGGCCCGCAGCAAACTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 966594346 3:181712426-181712448 CGGCAACTCCACCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 16
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966594346 Original CRISPR CGGCAACTCCACCGCGGCGG CGG Exonic
904679852 1:32221826-32221848 CGGCAACTCCACCGAGAGAGGGG + Intronic
904769064 1:32870905-32870927 CAGCGACTCCCGCGCGGCGGCGG + Intronic
907671419 1:56477754-56477776 CGGCCGTTCCTCCGCGGCGGGGG - Intergenic
915482141 1:156194213-156194235 CGGCGGCTCCACCGCGTCTGAGG - Exonic
920660423 1:207910342-207910364 CAGCAACCCCACCGCGGAGGAGG - Intronic
921472718 1:215567703-215567725 CGGCAGCTTCCCCGCGGCGGCGG + Exonic
923042916 1:230332759-230332781 CGCCACATCCACCGCAGCGGTGG + Intronic
923511724 1:234659025-234659047 CGACATCTCCACCGTGGTGGTGG + Intergenic
1069386111 10:67884754-67884776 CGGCGGCTCCCCCTCGGCGGCGG + Exonic
1101371884 12:104138027-104138049 CGCCAACGCCGCCGCGGCCGGGG - Intronic
1120993250 14:90396960-90396982 AGGCGGCTCCGCCGCGGCGGAGG + Intronic
1122300148 14:100726891-100726913 CGGCAGCTCCCCGGCAGCGGCGG + Exonic
1126063885 15:44810356-44810378 AGGCAGCTACACGGCGGCGGGGG - Intergenic
1128067849 15:64775580-64775602 CGGCGAGTGCGCCGCGGCGGCGG + Exonic
1134615767 16:15650261-15650283 CGGCGAGGCCAACGCGGCGGCGG - Intronic
1136553361 16:30993534-30993556 TGGCCACTCCACTGCGGTGGAGG - Intronic
1145058421 17:19717612-19717634 CGGCCACTCCTCCGCTGCAGGGG - Intronic
1147968226 17:44205660-44205682 CGGGAACTCTGCCGCGGAGGTGG - Exonic
1148561786 17:48610594-48610616 CGGCGACTCCGCCAAGGCGGCGG - Exonic
1152751538 17:82064780-82064802 CGGGAACCCAACCGCGGCCGCGG + Intronic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1161264619 19:3358657-3358679 CGGCCCCTCCTCCGCTGCGGAGG + Intergenic
1162033199 19:7926041-7926063 CGGCCTCTCCCCGGCGGCGGCGG + Exonic
928313761 2:30231209-30231231 CCCGAACTCCAGCGCGGCGGAGG - Intergenic
928549513 2:32357278-32357300 CGGCTGCTCCTCGGCGGCGGGGG + Exonic
931218027 2:60264247-60264269 CTGCAACTCCACCGAAGAGGGGG - Intergenic
937318787 2:120948461-120948483 TGGCAACTGCACCGTGGAGGCGG + Intronic
947550009 2:231038683-231038705 GGGCATCTCCAGCGCGGTGGAGG + Intronic
948487254 2:238288763-238288785 CGGCGACTCGGCCGCGGCGGAGG - Intronic
1171567737 20:26209570-26209592 CAGCACCCCCACCGCTGCGGAGG + Intergenic
1176547083 21:8206714-8206736 CGGCACCCCCACCGCCGCGGAGG - Intergenic
1176554988 21:8250923-8250945 CGGCACCCCCACCGCCGCGGAGG - Intergenic
1176566034 21:8389761-8389783 CGGCACCCCCACCGCCGCGGAGG - Intergenic
1176573910 21:8433947-8433969 CGGCACCCCCACCGCCGCGGAGG - Intergenic
1182158192 22:28096041-28096063 CGGCATATCCACTGCGGCTGAGG + Intronic
1203251958 22_KI270733v1_random:122999-123021 CGGCACCCCCACCGCCGCGGAGG - Intergenic
1203260011 22_KI270733v1_random:168081-168103 CGGCACCCCCACCGCCGCGGAGG - Intergenic
966594346 3:181712426-181712448 CGGCAACTCCACCGCGGCGGCGG + Exonic
969582197 4:8071951-8071973 AGGCAGTGCCACCGCGGCGGCGG + Intronic
970349027 4:15182583-15182605 AGGCAACTCCACAGAGGCAGAGG + Intergenic
971257811 4:25030426-25030448 AGGCAACTCCCTCGCGGCGGCGG + Intronic
976390708 4:84501283-84501305 CGGACACTCCACCCTGGCGGTGG + Intergenic
980541440 4:134201531-134201553 CGGCAGCGCCTCGGCGGCGGCGG - Intronic
982712209 4:158768950-158768972 CCGCAGCCCCACGGCGGCGGCGG - Intergenic
985696698 5:1344954-1344976 CGCCACCGCCACCGCCGCGGGGG + Exonic
997990800 5:138543122-138543144 CGGCTGCTCCTCCCCGGCGGCGG + Exonic
997990808 5:138543139-138543161 CGGCGGCTCCGCGGCGGCGGCGG + Exonic
1002784478 6:391550-391572 CGGGAACCCCACCCCGGCCGCGG + Intergenic
1013099575 6:106975155-106975177 CGGCTACCCCGCCGCAGCGGAGG - Intronic
1022363371 7:29685044-29685066 CGGGAACCTCCCCGCGGCGGCGG + Intergenic
1022427933 7:30285485-30285507 CGGGAACCTCCCCGCGGCGGCGG - Exonic
1022698011 7:32728695-32728717 CGGGAACCTCCCCGCGGCGGCGG - Intergenic
1029713768 7:102314570-102314592 CGGCATCTCGACCTCGGCTGTGG - Exonic
1034343435 7:150371913-150371935 CGGCATCTCCACCGGGCCGGGGG - Exonic
1035169500 7:157009837-157009859 CGGCTACTCCGCGGCGGCGGCGG - Exonic
1037900999 8:22689712-22689734 CGGCAGCAGCACCGCGTCGGCGG + Exonic
1039964033 8:42271177-42271199 GGGCGACTCCCCCGGGGCGGGGG - Intergenic
1040495521 8:47961570-47961592 CTGCAACTCCCCCGTGGAGGTGG - Exonic
1047998534 8:130358432-130358454 CGGCAGCTCCTCAGCGGCGGGGG + Intronic
1049150482 8:141032144-141032166 AGGAAGCTCCACCGCGGTGGAGG + Intergenic
1052991818 9:34523021-34523043 CCGCACCTCCTCCGCGGCCGCGG + Exonic
1053214425 9:36258641-36258663 CAGCAGCTCCAGCGCGGCAGAGG - Intronic
1057955969 9:99408266-99408288 GGGCAACTCCACCTCAGCAGAGG - Intergenic
1061472037 9:130834948-130834970 GCGCAACTCCACCGCGGCCTGGG - Intronic
1061860734 9:133467531-133467553 CGGAATCTCCACCGCGGAGAGGG - Intronic
1062332747 9:136051690-136051712 CGGCAACTTCTCCGCAGCGGGGG - Intronic
1062341411 9:136095305-136095327 CGGCGGCCGCACCGCGGCGGGGG + Intergenic
1062456403 9:136641298-136641320 CGTAAACTCCACCGTCGCGGGGG + Intergenic
1203468361 Un_GL000220v1:106149-106171 CGGCACCCCCACCGCCGCGGAGG - Intergenic
1203476182 Un_GL000220v1:150121-150143 CGGCACCCCCACCGCCGCGGAGG - Intergenic
1190260160 X:48792353-48792375 CAGCCACTCCACTGTGGCGGAGG + Exonic
1198051630 X:132957446-132957468 CGAGTACTCCACGGCGGCGGCGG + Intronic