ID: 966594701

View in Genome Browser
Species Human (GRCh38)
Location 3:181715168-181715190
Sequence ATTTCTTAAATTGGCAGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966594693_966594701 5 Left 966594693 3:181715140-181715162 CCTCTCTCTCCCTCTCTCCCTGA 0: 1
1: 7
2: 135
3: 1124
4: 7579
Right 966594701 3:181715168-181715190 ATTTCTTAAATTGGCAGCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 76
966594695_966594701 -5 Left 966594695 3:181715150-181715172 CCTCTCTCCCTGAATTCCATTTC 0: 1
1: 0
2: 3
3: 38
4: 392
Right 966594701 3:181715168-181715190 ATTTCTTAAATTGGCAGCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 76
966594694_966594701 -4 Left 966594694 3:181715149-181715171 CCCTCTCTCCCTGAATTCCATTT 0: 1
1: 0
2: 5
3: 49
4: 567
Right 966594701 3:181715168-181715190 ATTTCTTAAATTGGCAGCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 76
966594691_966594701 7 Left 966594691 3:181715138-181715160 CCCCTCTCTCTCCCTCTCTCCCT 0: 18
1: 510
2: 4280
3: 17954
4: 34362
Right 966594701 3:181715168-181715190 ATTTCTTAAATTGGCAGCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 76
966594692_966594701 6 Left 966594692 3:181715139-181715161 CCCTCTCTCTCCCTCTCTCCCTG 0: 4
1: 61
2: 520
3: 4033
4: 13908
Right 966594701 3:181715168-181715190 ATTTCTTAAATTGGCAGCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966594701 Original CRISPR ATTTCTTAAATTGGCAGCGC GGG Intergenic
902852592 1:19172004-19172026 TTTTCTTAAATTGGAAGAACTGG - Intronic
904143536 1:28371744-28371766 ATTTTTTTAATTAGCTGCGCTGG - Intronic
905145080 1:35882165-35882187 ACTTCTTAAATTTGAAGTGCTGG + Intronic
905761562 1:40562660-40562682 ATTTCTGAAATTGGAATTGCTGG + Intergenic
913157062 1:116110229-116110251 ACTTCTCAGATTGGCAGCGTAGG + Intergenic
916781134 1:168030923-168030945 TTTTCTTAAATAGGTAGCCCTGG + Intronic
916878609 1:168997682-168997704 GTTTTTTGAATTGTCAGCGCTGG + Intergenic
919166018 1:193893907-193893929 TTTTCTTAAATTATCAGCTCAGG - Intergenic
921434126 1:215097275-215097297 AGTTCTTAAATTGACAGCCATGG + Intronic
922983410 1:229847875-229847897 ATTTCTTAGAGTGGCAGTGGTGG + Intergenic
924392414 1:243577445-243577467 ATTTATTAAATAGGGAGTGCTGG - Intronic
924502670 1:244652194-244652216 CATTCTTAAATTGGCTGCACGGG - Intergenic
1068527139 10:58143295-58143317 ATTTCCTAAATTTGCAGTGATGG + Intergenic
1075634793 10:124023175-124023197 ATTTATTAAAATGGCAATGCAGG - Intronic
1076451566 10:130560396-130560418 ATATCTTAAGGAGGCAGCGCTGG - Intergenic
1086090152 11:82997261-82997283 ATTGTTTTAATTGGCAACGCTGG - Exonic
1086641582 11:89164619-89164641 ATGTCTTAAATTGTGAGCTCAGG + Intergenic
1092764266 12:11838612-11838634 ATTTCATTATTTGGCAGCTCTGG + Intronic
1094028933 12:25988652-25988674 ATTTCCTGAACTGGCAGTGCAGG - Intronic
1096196623 12:49652817-49652839 GTATCCTAAATTGGCAGGGCAGG - Intronic
1101942728 12:109111806-109111828 ATTTCTTAAAAGGGCAGGGAGGG + Intergenic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1109994238 13:70102453-70102475 ACTTCTTAAATTGACAGTGATGG - Intronic
1114358937 14:21948501-21948523 ATTTCTTAAATAGGCAACAGGGG + Intergenic
1115993626 14:39174024-39174046 AGTTCCTACATTGGCAGTGCAGG + Intergenic
1120578761 14:86219600-86219622 CTTTCATAAATTGGTAGCACTGG + Intergenic
1124784380 15:32665777-32665799 ATTCCTCAAATTGCCAGCTCTGG - Intronic
1136570532 16:31094011-31094033 AATTCTTAAAATGGCAAGGCTGG + Intronic
1137398161 16:48131688-48131710 ATTTCTTAAATGGGTAGCTAGGG - Intronic
1137457161 16:48626619-48626641 ATTTCTTAAATAGGCAACACAGG + Intergenic
1146363732 17:32201577-32201599 CTTTCTTAAATTGACAGAGCAGG + Intronic
1149020192 17:51954776-51954798 AATTATTAAATTGGAAGCCCTGG + Intronic
1150733761 17:67717938-67717960 TTTGCTCAAAATGGCAGCGCTGG + Exonic
1155929880 18:31695645-31695667 ATTACAAAAATTGGCAGCTCAGG - Intergenic
1156882460 18:42096767-42096789 ATGTTTTTAATTGGCAGCCCAGG - Intergenic
1158572054 18:58604702-58604724 ATTTTTCAAAATGGCAGCCCAGG + Intronic
928144995 2:28765591-28765613 TTGTCTTAACTTGGCAGCACGGG + Intronic
929520356 2:42644516-42644538 AATTCTAAAATTGGAAGTGCTGG - Intronic
935495450 2:103775468-103775490 ATTTCTTAATTTGGCAACTTGGG + Intergenic
937350832 2:121160006-121160028 ATTTCTTTAGTTGGGGGCGCTGG + Intergenic
939318264 2:140580389-140580411 ATTTCTGCAATTGGCAACACAGG - Intronic
941167505 2:162098505-162098527 ATTGCTCAAATTGACAGGGCTGG - Intergenic
941457041 2:165721483-165721505 ATTTCTTAAAGTGGATGCACAGG - Intergenic
945561956 2:211350463-211350485 ATTTATTAAATAGGCAGGGGTGG - Intergenic
1177930049 21:27270174-27270196 ATTTCTTACCATGGCAGAGCAGG + Intergenic
1180413566 22:12638554-12638576 ATTTTTTAAATTGGCTGTGCTGG - Intergenic
1181945554 22:26514523-26514545 ATTTCTTAAAATGAAAGCTCTGG + Intergenic
959893368 3:111581243-111581265 ATTTAGTAAATTGGCTGGGCGGG + Intronic
960228243 3:115192657-115192679 ATGTCTTATATTGCCAGAGCAGG - Intergenic
965645150 3:170872350-170872372 ATATCTTATATTGGAAGAGCTGG - Intergenic
966594701 3:181715168-181715190 ATTTCTTAAATTGGCAGCGCGGG + Intergenic
968220475 3:196934419-196934441 GTTTCTTAACTAGGCAGAGCAGG - Exonic
968463626 4:738539-738561 GTTTCTTAAAGTGTCAGCACTGG - Intronic
968962121 4:3750954-3750976 ATTTATTCAATTAGCAGGGCCGG - Intergenic
970187628 4:13477835-13477857 AATTTTTAAATTGGTAGTGCTGG + Intronic
972598004 4:40547213-40547235 ATTTATGAATTTGGCAGGGCAGG - Intronic
973628868 4:52799893-52799915 ATGTCTTACATGGCCAGCGCAGG + Intergenic
988139176 5:27213530-27213552 ATGTCTTACATCGGCAGAGCAGG + Intergenic
988438011 5:31198557-31198579 ATTTCCTAAATTGGTAGGTCTGG + Intronic
989084365 5:37659471-37659493 ATTTCTTAAAGTGGAAGCATAGG + Intronic
992762980 5:79967993-79968015 ATTACTTAAATTGGAACCGTTGG - Intergenic
997359227 5:133283905-133283927 ATGTCTTAATATGGCAGAGCAGG + Intronic
998555607 5:143120509-143120531 ATTTTTTAAATGGGCAGATCTGG - Intronic
1003184450 6:3818786-3818808 ATTTATTAAATTTGTAGCTCTGG + Intergenic
1010168252 6:72942071-72942093 CATTCTTAAAATGGCAGCTCAGG - Intronic
1014502406 6:122207936-122207958 ATTTCTGACATTGGCAAGGCAGG - Intergenic
1015312549 6:131781384-131781406 CTTTTTGAAATTGGCAGGGCAGG + Intergenic
1028110093 7:86929883-86929905 ATGTCTTAAATGGCCAGAGCAGG - Intronic
1034004508 7:147454823-147454845 TTTTCTTAAAGTTGCAGTGCTGG - Intronic
1034709001 7:153173961-153173983 ATGTCTTAAATGGCCAGAGCAGG - Intergenic
1035750470 8:1992447-1992469 TTTTCTTAAATTGGAAGCGGGGG + Intronic
1040645339 8:49390562-49390584 ATTTTCTAAATTGGCAGCATAGG + Intergenic
1042914182 8:73858474-73858496 ATTTCTTGAATTGGCAACGTAGG - Intronic
1047565864 8:126042665-126042687 ATATCTTAAGTTGGTAGAGCAGG + Intergenic
1049966604 9:785697-785719 GTTTCTTGAATCGGCAGCCCTGG - Intergenic
1052605731 9:30697624-30697646 ATGTCTTAAATAGCCAGCGCAGG + Intergenic
1055372295 9:75613107-75613129 ATTTTTGAAGTTGGCAGCACTGG + Intergenic
1055771761 9:79724538-79724560 CTTTCTTAAAATGGCAGAGGTGG - Intronic
1056815742 9:89799548-89799570 ATTTCTTTGATTGGCAGTGGTGG + Intergenic
1186576245 X:10769135-10769157 ATTTTCTAAATAGGCAGAGCAGG - Intronic
1187206024 X:17182228-17182250 ACTTCTTACATGGGCAGCTCAGG - Intergenic
1188223723 X:27571740-27571762 ATTTCTTATTATGGCAGCTCTGG - Intergenic
1188262890 X:28039320-28039342 ATTTCCCAAAGTAGCAGCGCTGG + Intergenic