ID: 966595871

View in Genome Browser
Species Human (GRCh38)
Location 3:181724379-181724401
Sequence CGCTGCCGGCGCGGGTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966595866_966595871 -10 Left 966595866 3:181724366-181724388 CCTTTTTCGCTCCCGCTGCCGGC No data
Right 966595871 3:181724379-181724401 CGCTGCCGGCGCGGGTGTACTGG No data
966595862_966595871 16 Left 966595862 3:181724340-181724362 CCCTCCTTTCGGGTCTGCGGCGT No data
Right 966595871 3:181724379-181724401 CGCTGCCGGCGCGGGTGTACTGG No data
966595864_966595871 12 Left 966595864 3:181724344-181724366 CCTTTCGGGTCTGCGGCGTCTGC No data
Right 966595871 3:181724379-181724401 CGCTGCCGGCGCGGGTGTACTGG No data
966595863_966595871 15 Left 966595863 3:181724341-181724363 CCTCCTTTCGGGTCTGCGGCGTC No data
Right 966595871 3:181724379-181724401 CGCTGCCGGCGCGGGTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966595871 Original CRISPR CGCTGCCGGCGCGGGTGTAC TGG Intergenic
No off target data available for this crispr