ID: 966595909

View in Genome Browser
Species Human (GRCh38)
Location 3:181724776-181724798
Sequence CAGTCCAAACACTCTATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966595902_966595909 -7 Left 966595902 3:181724760-181724782 CCCACCCCCATATACGCAGTCCA No data
Right 966595909 3:181724776-181724798 CAGTCCAAACACTCTATTGGAGG No data
966595898_966595909 11 Left 966595898 3:181724742-181724764 CCTCTACAAGCTCTACCCCCCAC No data
Right 966595909 3:181724776-181724798 CAGTCCAAACACTCTATTGGAGG No data
966595900_966595909 -5 Left 966595900 3:181724758-181724780 CCCCCACCCCCATATACGCAGTC No data
Right 966595909 3:181724776-181724798 CAGTCCAAACACTCTATTGGAGG No data
966595901_966595909 -6 Left 966595901 3:181724759-181724781 CCCCACCCCCATATACGCAGTCC No data
Right 966595909 3:181724776-181724798 CAGTCCAAACACTCTATTGGAGG No data
966595903_966595909 -8 Left 966595903 3:181724761-181724783 CCACCCCCATATACGCAGTCCAA No data
Right 966595909 3:181724776-181724798 CAGTCCAAACACTCTATTGGAGG No data
966595899_966595909 -4 Left 966595899 3:181724757-181724779 CCCCCCACCCCCATATACGCAGT No data
Right 966595909 3:181724776-181724798 CAGTCCAAACACTCTATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966595909 Original CRISPR CAGTCCAAACACTCTATTGG AGG Intergenic
No off target data available for this crispr