ID: 966599183 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:181758376-181758398 |
| Sequence | GGTTAGGTCTAGATGCCAAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 966599183_966599186 | -9 | Left | 966599183 | 3:181758376-181758398 | CCTGTTGGCATCTAGACCTAACC | No data | ||
| Right | 966599186 | 3:181758390-181758412 | GACCTAACCTGGGTTAGTTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 966599183 | Original CRISPR | GGTTAGGTCTAGATGCCAAC AGG (reversed) | Intergenic | ||