ID: 966599186

View in Genome Browser
Species Human (GRCh38)
Location 3:181758390-181758412
Sequence GACCTAACCTGGGTTAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966599183_966599186 -9 Left 966599183 3:181758376-181758398 CCTGTTGGCATCTAGACCTAACC No data
Right 966599186 3:181758390-181758412 GACCTAACCTGGGTTAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966599186 Original CRISPR GACCTAACCTGGGTTAGTTC AGG Intergenic