ID: 966603400

View in Genome Browser
Species Human (GRCh38)
Location 3:181797575-181797597
Sequence AGGAATATACACTTTGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966603398_966603400 0 Left 966603398 3:181797552-181797574 CCAATTATAAGACAAGAAATGTC No data
Right 966603400 3:181797575-181797597 AGGAATATACACTTTGAGAGTGG No data
966603397_966603400 23 Left 966603397 3:181797529-181797551 CCTACAGCTCTCATTCATAAAGT No data
Right 966603400 3:181797575-181797597 AGGAATATACACTTTGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966603400 Original CRISPR AGGAATATACACTTTGAGAG TGG Intergenic
No off target data available for this crispr