ID: 966603846

View in Genome Browser
Species Human (GRCh38)
Location 3:181802074-181802096
Sequence ATCAACCAATTTTAGCAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966603846_966603849 27 Left 966603846 3:181802074-181802096 CCTCATTGCTAAAATTGGTTGAT No data
Right 966603849 3:181802124-181802146 AGTAATGTATGTAAAACAATTGG No data
966603846_966603847 -7 Left 966603846 3:181802074-181802096 CCTCATTGCTAAAATTGGTTGAT No data
Right 966603847 3:181802090-181802112 GGTTGATAAATTTACATCTGAGG No data
966603846_966603848 -6 Left 966603846 3:181802074-181802096 CCTCATTGCTAAAATTGGTTGAT No data
Right 966603848 3:181802091-181802113 GTTGATAAATTTACATCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966603846 Original CRISPR ATCAACCAATTTTAGCAATG AGG (reversed) Intergenic
No off target data available for this crispr