ID: 966603849

View in Genome Browser
Species Human (GRCh38)
Location 3:181802124-181802146
Sequence AGTAATGTATGTAAAACAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966603846_966603849 27 Left 966603846 3:181802074-181802096 CCTCATTGCTAAAATTGGTTGAT No data
Right 966603849 3:181802124-181802146 AGTAATGTATGTAAAACAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966603849 Original CRISPR AGTAATGTATGTAAAACAAT TGG Intergenic
No off target data available for this crispr